Gene Information: F16A11.1
| Name | F16A11.1 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | F16A11.1 |
| Genetic position | I:3.76 +/- 0.000 cM |
| Genomic position | I: 9393761..9404039 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| BC14616 | dpy-5(e907) I; sEx14616. | sEx14616 [rCes F16A11.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). |
| VC4091 | F16A11.1(gk5179) I; H23N18.4(gk5180) K11G9.2(gk5181) V. | Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5179 mutation is C->T, flanking sequences GGTGAAGCTGAGGCATTACGCGCTTCTCGT and TGAAAAATTTTAATGGATTTTTTGATTCTT. The gk5180 mutation is G->A, flanking sequences AAACTGAAAAGAAGACGTTTCCAATGCTTT and GGATTCTCAACTTATGAATAATCCGATATT. The gk5181 mutation is T->A, flanking sequences AGCATTTGCAGACGGAGATTTTACAACTTG and GAAGAAAATTTTAAAAGACGAGTTGAATCC. |