Gene Information: C33A12.1
Name | C33A12.1 View on WormBase |
---|---|
Species | C. elegans |
Sequence | C33A12.1 |
Genetic position | IV:4.29 +/- 0.000 cM |
Genomic position | IV: 9523756..9524899 |
Strains carrying this gene
Strain | Genotype | Description |
---|---|---|
BC14160 | dpy-5(e907) I; sEx14160. | sEx14160 [rCes C33A12.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). |
VC4444 | C33A12.1(gk5519[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. | Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1803 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TGGCCAAGATATTTTACGACATCACCACCC; Right flanking sequence: GCAGTTTAGTGCTCCACGAATTAAATTTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |