Gene Information: sra-25
| Name | sra-25 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | T26E3.9 |
| Genetic position | I:13.92 +/- 0.004 cM |
| Genomic position | I: 12686116..12688206 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| BC13401 | dpy-5(e907) I; sIs12199. | sIs12199 [rCes T26E3.9::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). |
| RG3025 | sra-25(ve525[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. | Homozygous viable. Deletion of 1944 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGTGTGTTTGGTGAATTCCGTTTTCCACCA ; Right flanking sequence: atgacaatttctggatttttgggtacatct. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |