Gene Information: gcst-1
| Name | gcst-1 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | F25B4.1 |
| Genetic position | V:-1.16 +/- 0.000 cM |
| Genomic position | V: 5712928..5714737 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| BC12891 | dpy-5(e907) I; sIs11014. | sIs11014 [rCes F25B4.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). |
| VC4058 | gcst-1(gk5132[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27P::neoR::unc-54 3' UTR + loxP]) V. | Homozygous viable. Deletion of 1302 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CCACACTGCTCAATGCGTCGCGCTGCTTCT ; Right flanking sequence: ATTTCCCTGGAGCTGAACATATTGTGAAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |