Gene Information: nlp-43
| Name | nlp-43 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | C45G9.13 |
| Genetic position | III:-2.21 +/- 0.000 cM |
| Genomic position | III: 5042412..5044672 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| BC12616 | dpy-5(e907) I; sIs12377. | sIs12377 [rCes C45G9.13::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). |
| PS8691 | nlp-43(sy1463) III. | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-43. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: gctcggaagtATGTCGTTGGCTCAATCTACCTTCT right flanking sequence: ACCTTCTATTTGTTGCATTTTTGGCAGTTGTGATC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGCAACAAATAGAAGGTAGA Method Reference: G3 (Bethesda). |