Gene Information: sra-38
| Name | sra-38 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | T21H8.3 |
| Genetic position | X:15.12 +/- 0.000 cM |
| Genomic position | X: 13897934..13900147 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| BC12005 | dpy-5(e907) I; sEx12005. | sEx12005 [rCes T21H8.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). |
| RG3024 | sra-38(ve524[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. | Homozygous viable. Deletion of 1918 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AATAGCAATGATGAAAACATTAGTGGCATA ; Right flanking sequence: GGTGGTGATAGAGAAGTCCGTTTGACTCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |