Gene Information: sra-4
| Name | sra-4 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | AH6.8 |
| Genetic position | II:1.53 +/- 0.003 cM |
| Genomic position | II: 9541601..9542885 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| BC11958 | dpy-5(e907) I; sEx11958. | sEx11958 [rCes AH6.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). |
| RG3004 | sra-4(ve504[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. | Homozygous viable. Deletion of 1294 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ggtgtgaaagattttaaataaacaccctcg ; Right flanking sequence: CAAGGACATtctttaaaagtaaaaagaacc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |