Gene Information: drd-1
| Name | drd-1 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | F49E12.9 |
| Genetic position | II:0.77 +/- 0.000 cM |
| Genomic position | II: 8388051..8389891 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| BC11770 | dpy-5(e907) I; sEx11770. | sEx11770 [rCes F49E12.9::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). |
| VC4243 | drd-1(gk5327[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. | Homozygous viable. Deletion of 1524 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: ATCTACGACTATTTCGATGGTGACCCACTG; Right flanking sequence: CTGGGCATCGAATAGCATTAACAGATTCTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |