Caenorhabditis Genetics Center (CGC)

Gene Information: cmk-1

Namecmk-1 View on WormBase
Species C. elegans
SequenceK07A9.2
Genetic positionIV:-15.58 +/- 0.283 cM
Genomic positionIV: 1824481..1834247

Strains carrying this gene

Strain Genotype Description
BC10812 dpy-5(e907) I; sIs10602. sIs10602 contains [rCes K07A9.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
PY1589 cmk-1(oy21) IV. Thermotaxis defective.
VC220 cmk-1(ok287) IV; gkDf56 Y102A5C.36(gk3558) V. This strain is homozygous for a deletion (ok287) in K07A9.2, detectable by PCR using the following primers. External left primer: CAGTGCCTTTAGGGCTTGAG. External right primer: GGGGTACTGTGGCTGAAAAA. Internal left primer: TAAATCAAACGCCCTTGGAA. Internal right primer: AAACGAAAACCCGGAGAAAT. Internal WT amplicon: 2970 bp. Deletion size: 1921 bp. Deletion left flank: TGCCTAGGATCTGGGGTAGGCCTAGGATCTGGGGTAGGCCTAGGATCTGGGGTAGGCCT AGGATCTGGGGTAGGCCTAGGATC. Deletion right flank: GAAATACGGCGTACACACACGATATTCACG. Validation: ok287 passed by CGH. Other deletions (gkDf56 and gk3558) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807