| BC3119 |
unc-5(e152) unc-22(s7) let-99(s1201) unc-31(e169) IV/nT1 IV; +/nT1 V. |
Heterozygotes are WT and segregate WT, Egl, UncLet (maternal effect lethal) and dead eggs. Maintain by picking WT. |
| EU1472 |
let-99(or204) IV; him-5(e1490) V. |
let-99(or204) is temperature-sensitive, maternal-effect, embryonic-lethal. Nearly completely penetrance of lethality at 26C. Viable at 15C. Maintain at 15C. Reference: Goulding MB, et al. J Cell Biol. 2007 Sep 24;178(7):1177-91. |
| EU363 |
let-99(or81) IV/nT1 [unc-?(n754) let-?] (IV;V). |
Heterozygotes are Unc. |
| TH112 |
let-99(dd17) IV/nT1 [qIs51] (IV;V). |
let-99(dd17) contains a 647bp deletion with the flanking sequences aatttttaggaagtttccagaaatttttcc / CAAGGCTCCCACGAAGATTATCGCGATCTA. The deletion removes the N terminus of the open reading frame including the start codon and the DEP domain. Heterozygotes are GFP+ in the pharynx. dd17 is a maternal effect lethal mutation. |
| TH113 |
let-99(dd18) IV/nT1 [qIs51] (IV;V). |
let-99(dd18) contains a 1039bp deletion with the flanking sequences TTTGGATGAGTTGAAGCATCCCAAGCCCCG / ATGAATGCTCTCTTATTGTTAATCTCCTCT. The deletion starts behind the DEP domain. Heterozygotes are GFP+ in the pharynx. dd18 is a maternal effect lethal mutation. |
| VC940 |
let-99(ok1403) IV/nT1 [qIs51] (IV;V). |
K08E7.3. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP ok1403 homozygotes (Mel; adult lays eggs, some hatch into abnormal L1s that arrest). nT1[qIs51] homozygotes inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |