| BC3119 |
unc-5(e152) unc-22(s7) let-99(s1201) unc-31(e169) IV/nT1 IV; +/nT1 V. |
Heterozygotes are WT and segregate WT, Egl, UncLet (maternal effect lethal) and dead eggs. Maintain by picking WT. |
| BC369 |
unc-5(e152) let-55(s45) unc-22(s7)/unc-5(e152) IV. |
Heterozygotes are Unc and segregate Unc and Lethal Unc Twitchers. Lethal early larval. Heterozygotes twitch in 1% nicotine. |
| BC964 |
let-56(s46) unc-22(s7)/unc-5(e152) dpy-4(e1166) IV. |
Heterozygotes are WT and segregate more WT, DpyUncs and Lethal Twitchers. Lethal late larval. Heterozygotes Twitch in 1% Nicotine. Pick WT to maintain. |
| BC965 |
let-59(s49) unc-22(s7)/unc-5(e152) dpy-4(e1166) IV. |
Heterozygotes are WT and segregate WT, DpyUnc and Lethal Twitchers. Lethal early larval. Hets twitch in 1% Nicotine. Pick WT to maintain. |
| BC966 |
let-60(s59) unc-22(s7)/unc-5(e152) dpy-4(e1166) IV. |
Heterozygotes are WT and segregate WT, DpyUnc, and Lethal Twitchers. Lethal mid-larval (leaky). Heterozygotes twitch in nicotine. |
| CB1039 |
unc-5(e53) IV; nuc-1(e1392) X. |
Unc. DNAse undetectable. Gut DNA fluoresence abnormal. M-MATING-NO SUCCESS. |
| CB152 |
unc-5(e152) IV. |
Unc. |
| CB3695 |
fem-1(e1965)/unc-5(e53) mor-2(e1125) IV. |
WT heterozygote, fem-1(e1965) maternal. Segregates WT heterozygotes, WT fem-1 homozygotes that give only fertile female progeny, and UncMor. (Probably has lost mor-2 [Edgley, 4/92]. When confirmed, should be given a new strain name.) |
| CB4457 |
fem-1(e2342) / unc-5(e53) mor-2(e1125) IV. |
Wild-type hermaphrodites segregating WT, Fem, Unc Mor. Maintain by picking wild-type hermaphrodites. Deletion allele of fem-1, with unusual maternal effect. Reference: Spence AM, et al. Cell. 1990 Mar 23;60(6):981-90. Johnson CL & Spence AM.. Science. 2011 Sep 2;333(6047):1311-4. |
| CB4760 |
fem-1(e2044) mor-2(e1125) unc-24(e158) fem-3(q20) / unc-5(e53) dpy-20(e1282) IV |
Wild-type hermaphrodites segregating wild-type hermaphrodites, Unc-24 females, Unc Dpy hermaphrodites. Maintain by picking wild-type hermaphrodites. Deletion allele of fem-1, with unusual maternal effect. Reference: Spence AM, et al. Cell. 1990 Mar 23;60(6):981-90. Johnson CL & Spence AM.. Science. 2011 Sep 2;333(6047):1311-4. |
| CGC11 |
unc-5(e53)/nT1 [umnIs1] IV; dpy-11(e224)/nT1 V. |
umnIs1 [eft-3p::GFP + HygroR, V:~2821000] V. umnIs1 GFP is expressed at low levels, and might be difficult to see in heterozygotes. Heterozygotes are WT and segregate WT, DpyUnc, Vul and dead eggs. Maintain by picking GFP+ WT. Derived by insertion of GFP transgene into parental strain MT1000 using MosSCI. |
| CGC13 |
unc-5(e53)/nT1 [umnIs3] IV; dpy-11(e224)/nT1 V. |
umnIs3 [eft-3p::NLS::tdTomato + HygroR, V:~2821000] IV. tdTomato is expressed at low levels, and might be difficult to see in heterozygotes. Heterozygotes are WT and segregate WT, DpyUnc, Vul and dead eggs. Maintain by picking WT with tdTomato expression. Derived by insertion of tdTomato transgene into parental strain MT1000 using CRISPR/Cas9. |
| CGC33 |
unc-5(e53)/nT1 [umnIs22] IV; dpy-11(e224)/nT1 V. |
umnIs22 [myo-2p::GFP + NeoR, V: 1005689 (intergenic)] IV. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc, Vul GFP+ (nT1) and dead eggs. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into nT1 balancer in parental strain MT1000 using CRISPR/Cas9. |
| CGC39 |
unc-5(e53)/nT1 IV; dpy-11(e224)/nT1 [umnIs28] V. |
umnIs28 [myo-2p::GFP + NeoR, IV: 12457861 (intergenic)] V. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc, Vul GFP+ (nT1) and dead eggs. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into nT1 balancer in parental strain MT1000 using CRISPR/Cas9. |
| CGC63 |
unc-5(e53)/nT1 [umnIs49] IV; dpy-11(e224)/nT1 V. |
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc, Vul mKate2+ (nT1) and dead eggs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into nT1 balancer in parental strain MT1000 using CRISPR/Cas9. |
| CGC71 |
unc-5(e53)/nT1 IV; dpy-11(e224)/nT1 [umnIs57] V. |
umnIs57 [myo-2p::mKate2 + NeoR, IV: 12457861 (intergenic)] V. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc, Vul mKate2+ (nT1) and dead eggs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into nT1 balancer in parental strain MT1000 using CRISPR/Cas9. |
| DLW14 |
unc-5(lib1[myo-3p::GFP(-) + unc-119(+) + myo-2p::GFP(Mos1)]) IV; krIs14 V. |
krIs14 [hsp-16.48p::MosTransposase + lin-15(+) + unc-122p::GFP] V. Recessive Unc. unc-5(lib1) is a CRISPR/Cas9 engineered mutant carrying the Intersister/Intrachromatid Repair Assay (ICR Assay) cassette inserted into the endogenous unc-5 locus. Briefly, ICR assay cassette includes two tandem GFP cassettes: the upstream using the myo-3 (body wall) promoter with a truncated GFP coding sequence, and the down-stream using the myo-2 (pharynx) promoter with GFP coding sequence interrupted by a Mos1 Drosophila transposon. Excision of Mos1 yields a single DSB, which if repaired by intersister or intrachromatid recombination, then will yield GFP+ progeny. The krIs14 insertion carrying heat-shock inducible Mos1 transposase is marked with coelomocyte GFP expression. Reference: Toraason E, et al. Current Biology 2021. https://doi.org/10.1016/j.cub.2021.03.008 |
| DR169 |
che-3(e1378) I; unc-5(e53) IV. |
Dauer defective. Unc-coiler. |
| DR170 |
unc-5(e53) IV; che-2(e1033) X. |
Dauer defective. Unc-coiler. |
| DR640 |
ama-1(m118) unc-5(e53) IV. |
Hypercontracted and amanitin resistant. |
| DR690 |
unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-272(m243) IV. |
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc, and DpyLet. |
| DR691 |
unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-287(m244) IV. |
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLet. The DpyLets are sterile adults. Maintain by picking semi-Dpy. |
| DR692 |
unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-275(m245) IV. |
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLets. Lethal mid-larval. Maintain by picking semi-Dpy. |
| DR694 |
unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-281(m247) IV. |
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLet. The DpyLets are adult steriles. Maintain by picking semi-Dpy. |
| DR695 |
unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-285(m248) IV. |
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLet. The DpyLet are adult steriles. Maintain by picking semi-Dpy. |
| DR703 |
unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-274(m256) IV. |
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc, and DpyLets. Lethal early larval. Maintain by picking semi-Dpy. |
| DR705 |
unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-282(m258) IV. |
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLet. Lethal early larval. Maintain by picking semi-Dpy. |
| DR706 |
unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-280(m259) IV. |
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLets. The DpyLets are adult steriles. Maintain by picking semi-Dpy. |
| DR709 |
unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-279(m261) IV. |
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLets. The DpyLets are adult steriles. Maintain by picking semi-Dpy. |
| DR710 |
unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-277(m262) IV. |
Heterozygotes are semi-Dpy and segregate semi-Dpys, Uncs and Lets. Lethal mid-larval. Maintain by picking semi-Dpy. |
| DR711 |
unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-273(m263) IV. |
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLet. Lethal early larval. Maintain by picking semi-Dpy. |
| DR715 |
unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-284(m267) IV. |
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLet. Lethal early larval. Maintain by picking semi-Dpy. |
| DR717 |
unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-286(m269) IV. |
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLet. The DpyLet are adults which lay eggs that do not hatch. Maintain by picking semi-Dpy. |
| DR767 |
unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-288(m306) IV. |
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc, and DpyLets. DpyLets are adult steriles. Maintain by picking semi-Dpy. |
| EU84 |
unc-5(e53) skn-1(zu67) IV/nT1 [let-?(m435)] (IV;V). |
Heterozygotes are WT and segregate WT, Uncs which give only dead eggs, and dead eggs. |
| FX30203 |
tmC25 [unc-5(tmIs1241)] IV. |
Break points: In(mak-2 unc-8 In(kvs-5 dmd-9)) IV. Covered region (Mb) 6.5 (0.7..7.2) Balancer marked with myo-2p::Venus. Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241. |
| FX30257 |
tmC25 [unc-5(tm9708)] IV. |
Break points: In(mak-2 unc-8 In(kvs-5 dmd-9)) IV. Covered region (Mb) 6.5 (0.7..7.2) Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241. |
| JK3087 |
ehn-3(q689) unc-5(e53) IV. |
Unc. About 20% have single gonad arm. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| JK551 |
unc-5(e53) fem-3(q22) IV. |
Temperature sensitive. At 25C, XX germline makes only sperm; at 15C, germline makes oocytes and excess sperm. Unc. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| MT1000 |
unc-5(e53)/nT1 IV; dpy-11(e224)/nT1 V. |
Heterozygotes are WT and segregate WT, DpyUnc, Vul and dead eggs. Maintain by picking WT. |
| MT2867 |
unc-36(e251) III; unc-5(e53) IV; dpy-11(e224) V; lon-2(e678) lin-15B&lin-15A(n765) X. |
|
| MT3918 |
unc-5(e53) sem-3(n1655) IV. |
|
| MT464 |
unc-5(e53) IV; dpy-11(e224) V; lon-2(e678) X. |
Mapping strain. DpyUnc. |
| MT4867 |
unc-5(e53) lin-45(n2018) IV. |
Unc. n2018 is cold sensitive. Most animals at 15C are Vul/Let. AT 25C, 25% of the animals are non-Vul. |
| MT5240 |
unc-5(e53) lin-33(n1043) bli-6(sc16) IV. |
Unc. Vul. Blistered. |
| MT5241 |
unc-5(e53) unc-44(e362) IV. |
Unc. |
| MT5242 |
unc-5(e53) bli-6(sc16) IV. |
Blistered Unc. |
| NC1730 |
unc-5(e152) IV; wdIs52. |
wdIs52 [F49H12.4::GFP + unc-119(+)]. PVD defects in primary branch guidance, number of secondary branches, and tertiary branches are longer than wild-type. |
| RG3115 |
vha-11(ve615[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC25 [unc-5(tm9708)]. |
Homozygous Emb. Deletion of 5698 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, non-GFP unc-5(tm9708) homozygotes, and GFP+ dead embryos(ve615). |
| RG3193 |
cct-8(ve693[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC25 [unc-5(tm9708)] IV. |
Homozygous larval lethal. Deletion of 5958 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ dead larvae (ve693 homozygotes) and Unc animals (tmC25 [unc-5(tm9708)] homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: CACGTGGTTTTGGTCCTCCAGTCGCCTGCT ; Right flanking sequence: CGGTTCCTTTGAAGTGCTGAGCTCCTTCCT. sgRNA #1: TCAGATTATTATGTCAAAGC; sgRNA #2: GCACTTCAAAGGAACCGACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |