| DR226 |
him-1(e879) unc-54(m36) I. |
Unc. Semi-parlayzed. Segregates males. Heterozygotes are slow moving. |
| DR290 |
unc-54(m36) I; him-8(e1489) IV. |
Severe Unc. Segregates males. M-MATING-NO SUCCESS. Semi-dominant. Heterozygotes are slow moving. |
| DR291 |
unc-54(e675) I; eDp23 V. |
Not suppressed. Unc-slow moving. |
| DR31 |
unc-54(m31) I. |
Severe Unc. Very slow growth. Strong semi-dominant. Heterozygous males don't mate. |
| DR32 |
unc-54(m32) I. |
Severe Unc. Growth slow. Recessive. |
| DR33 |
unc-54(m33) I. |
Movement very slow. Recessive. |
| DR34 |
unc-54(m34) I. |
Moves relatively well. Recessive. |
| DR36 |
unc-54(m36) I. |
Severe homozygous Unc. Heterozygotes are slow moving. Weakly semi-dominant. Body muscle abnormal. |
| DR37 |
unc-54(m37) I. |
Healthy. Recessive. Dauer recovery slow. Eggs laid rarely. |
| DR404 |
unc-54(e1258) I; eDf1 eDp21/+ V. |
|
| DR405 |
unc-54(e190) I; eDf1 eDp21/+ V. |
|
| DR631 |
unc-54(e190) I; sus-1(m156) III. |
Severly paralyzed Unc. More severe than unc-15 alone. |
| GW1119 |
lsm-8 (xe17[myo-2p::mCherry::unc-54 3'UTR]) IV/nT1 [qIs51] (IV;V); pkIs1582 V/nT1 [qIs51] (IV;V). |
pkIs1582 [let-858::GFP + rol-6(su1006)] V. Homozygous lethal lsm-8 deletion balanced by GFP-marked nT1 translocation. xe17 generated by CRISPR/Cas9-engineered replacement of the gene with a red pharyngeal marker. lsm-8 heterozygotes are wild-type (will roll in this case because of pkIs1582) green & red pharynx, and will segregate rolling heterozygotes (green & red pharynx), arrested nT1[qIs51] aneuploids (only green pharynx), and lsm-8 homozygotes (only red pharynx). Homozygous nT1[qIs51] inviable. Pick rollers with green & red pharynx and check for correct segregation of progeny to maintain. Reference: Mattout A, et al. Nat Cell Biol. 2020 May;22(5):579-590. PMID: 32251399 |
| HR505 |
unc-59(e261) tba-2(sb51)/hIn1 [unc-54(h1040)] I. |
Dominant temperature sensitive maternal-effect embryonic lethal. Maintain at 15C. Heterozygotes are WT. hIn1 homozygotes are Unc. Early cleavage spindles small and misoriented, cytokinesis often incomplete. Recessive non-temperature sensitive maternal-effect embryonic lethal (but sterile in conjuction with unc-59). |
| JJ1068 |
hmp-2(zu364)/hIn1 [unc-54(h1040)] I. |
hmp-2(zu364) homozygotes are 99% embryonic or L1 lethal due to a defect in embryonic body elongation; approximately 1% survive to adult stages. Well balanced by hIn1. Maintain by picking WT. |
| JJ1743 |
par-6(tm1425)/hIn1 [unc-54(h1040)] I; him-8(e1489) IV. |
Heterozygotes are WT and segregate WT, Uncs, dead larvae (par-6 homozygotes) and males. |
| KK818 |
par-6(zu222) unc-101(m1)/hIn1 [unc-54(h1040)] I. |
Heterozygotes are WT and segregate WT, paralyzed Unc, and Coilers which give only dead eggs (slightly leaky, but survivors are agametic). zu222 is a strict maternal effect embryonic lethal. Partitioning defect similar to that of par-3; fails to localize PAR-3 protein. |
| KR2151 |
hIn1 [unc-54(h1040)] I. |
Clear, paralyzed. Mutation is included in the hIn1 inversion. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose. |
| KR2837 |
hDf16 unc-59(e261)/hIn1 [unc-54(h1040)] I. |
Wild-type phenotype. Segregates WT, Unc-54 (hIn1[unc-54] homozygotes), dead eggs (hDf16 homozygotes). Pick WT and check for correct segregation of progeny to maintain. See WBG 14: 29. This deletion was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose. CGC received new stock 9/3/97. |
| KR2838 |
hDf17/hIn1 [unc-54(h1040)] I. |
Wild-type phenotype. Segregates WT, Unc-54 (hIn1[unc-54] homozygotes), dead eggs (hDf17 homozygotes). Pick WT and check for correct segregation of progeny to maintain. See WBG 14: 29. This deletion was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose. CGC received new stock 9/3/97. |
| KR2839 |
hDf15 unc-75(e950)/hIn1 [unc-54(h1040)] I. |
Wild-type phenotype. Segregates WT, Unc-54 (hIn1[unc-54] homozygotes), dead eggs (hDf15 homozygotes). Pick WT and check for correct segregation of progeny to maintain. See WBG 14: 29. This deletion was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose. CGC received new stock 9/3/97. |
| ML773 |
rga-2(hd102)/hIn1 [unc-54(h1040)] I. |
Heterozygotes are WT and segregate WT, dead eggs, and paralyzed Uncs. Stable. |
| MT3778 |
ced-1(e1735) unc-54(e1092) I. |
Unc. Abnormal cell death. |
| MT6183 |
bli-3(e767) unc-54(e1092) I. |
Mapping strain. |
| NA39 |
gus-1(b405) unc-54(e190) I. |
Undectectable levels of b-glucuronidase activity. Limp paralysed phenotype at all stages. Larvae can move slightly more than adults. Egl. |
| PC72 |
ubIs5. |
ubIs5 [hsp16.1::hsp-16A::lacZ + rol-6(su1006)]. Transgene contains the complete hsp16.48 and hsp16-1 gene pair of locus hsp16A with lacZ cloned in-frame into the second exon of hsp16.1. The contruct contains the SV40 nuclear localization signal fused to the beginning of the lacZ coding region. Published as ubIn5. |
| PD126 |
unc-54(e190) I; ccIs126. |
ccIs126 [myo-2p::lacZ + unc-54(+)]. lacZ expression in pharyngeal and body wall muscles. Superficially wild-type, but gives some paralyzed animals. |
| PD2856 |
unc-54(cc2856[unc-54::gfp]) I. |
Green body muscle filaments, slightly sluggish movement. Functional translational fusion that provides a means to observe striated muscle thick filaments in real time. Reference: Nature. 2016 Jun 30;534(7609):719-23. |
| PD2859 |
unc-54(cc2859[unc-54::GFP::TAA::NSUTR]) I. |
Endogenous unc-54::GFP made by CRISPR. Exhibits green thick muscle filaments in the body wall muscle. Weakly Unc. Reference: Arribere JA, Cenik ES, Jain N, Hess GT, Lee CH, Bassik MC, Fire AZ. Translation readthrough mitigation. Nature. 2016 Jun 30;534(7609):719-23. Epub 2016 Jun 1. |
| PD2882 |
unc-54(cc2882[unc-54[G387R]::gfp::TAA::NSUTR]) I. |
cc2882 is a CRISPR/Cas9-induced G387R mutation of unc-54 in parental strain PD2859, mimicking the molecular lesion e1301. Unc at room temperature. Reference: Arribere JA & Fire AZ. ELife, vol. 7, Aug. 2018, doi:10.7554/elife.33292. |
| PD4092 |
unc-54(cc4092[unc-54::GFP::T2A::nonstop]) I. |
Unc. Reporter for non-stop mRNA decay, separate from non-stop protein decay. Reference: Arribere JA & Fire AZ. ELife, vol. 7, Aug. 2018, doi:10.7554/elife.33292. |
| PD8117 |
smg-1(cc545) unc-54(r293) I. |
Temperature sensitive. Partially suppressed Unc at 25C. Unc at 16C. [NOTE: The temperature-sensitive allele cc545 causes a T761I change in SMG-1. The lesion is a aca>ata transition in exon 35. Flanking sequences follow with the mutation site indicated with a capital C: tggattattaatcagact gcaaacttttgcattgtgaataaaatgaagaCaccattaggaaaaccaat gcagacttttgcagcttttgagaatgaaatta Pedone ... Reiner G3 (2021).] |
| PD8118 |
smg-1(cc546) unc-54(r293) I. |
Temperature sensitive. Partially suppressed Unc at 25C. Unc at 16C. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).] |
| PJ1002 |
unc-13(e51) I; ccIs55 V. |
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Unc. |
| PJ1015 |
unc-29(e1072) I; ccIs55 V. |
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Unc. |
| PJ1034 |
lev-1(e211) IV; ccIs55 V. |
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Resistant to 1 mM levamisole. |
| PJ1036 |
unc-38(e264) I; him-8(e1489) IV; ccIs55 V. |
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Him. Resistant to 1 mM levamisole. |
| PJ1037 |
unc-54(e190) I; ccIs55 V. |
ccIs55 [unc-54::lacZ + sup-7(st5)] V. |
| PJ1039 |
unc-47(e307) III; ccIs55 V. |
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Unc. Slight shrinking when poked. |
| PJ1046 |
cha-1(p1182) IV; ccIs55 V. |
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Unc lethal at 25C. Difficult to score <25C. |
| PJ1062 |
let-60(n1046) IV; ccIs55 V. |
ccIs55 [unc-54::lacZ + sup-7(st5)] V. |
| PJ1063 |
let-60(ga89) IV; ccIs55 V. |
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Temperature sensitive. Nearly WT at 15C. At 20C the animals are 18% Muv and brood size is 88. At 25C the animals are 57% Muv and are almost sterile (brood size is 6). |
| PJ1065 |
let-60(n2021) IV; ccIs55 V. |
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Vul/Egl. ras loss-of-signal. |
| PJ1069 |
let-60(sy93) IV; ccIs55 V. |
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Dominant Vul allele, however, worms appear to be Egl and have multiple pseudovulvae (due to sup-7??). |
| PJ1070 |
clr-1(e1745) II; ccIs55 V. |
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Clear. Grows very poorly at 25C. |
| PJ1076 |
ccIs55 V; gap-1(ga133) X. |
ccIs55 [unc-54::lacZ + sup-7(st5)] V. |
| PJ1078 |
clr-1(e1745) II; ccIs55 V; egl-15(n1783) X. |
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Non-Egl. Non-Scrawny. Class IV egl-15 mutation. Supresses the temperature-sensitive Clr phenotype. |
| PJ1080 |
age-1(hx546) II; ccIs55 V. |
ccIs55 [unc-54::lacZ + sup-7(st5)] V. |
| PJ1085 |
soc-2(n1774) IV; ccIs55 V. |
ccIs55 [unc-54::lacZ + sup-7(st5)] V. |
| PJ1092 |
lin-45(sy96) IV; ccIs55 V. |
ccIs55 [unc-54::lacZ + sup-7(st5)] V. |