| AM140 |
rmIs132 I. |
rmIs132 [unc-54p::Q35::YFP]. AM140 animals show a Q35::YFP progressive transition from soluble to aggregated as they age. |
| AM141 |
rmIs133. |
rmIs133 [unc-54p::Q40::YFP]. AM141 animals show a soluble Q40::YFP distribution in body wall muscle cells immediately after hatching. As these worms age the rapid formation of foci is observed. When they reach adulthood, AM141 animals show an entirely Q40::YFP aggregated phenotype. |
| ATD6 |
par-6(zu222) unc-101(m1)/hIn1[unc-54(h1040)] I; unc-119(ed3) III; zuIs45 V. |
zuIs45 [nmy-2p::nmy-2::GFP + unc-119(+)] V. Balanced worms are wild-type and segregate wild-type (heterozygotes), Coil Par (par-6 unc-101 homozygotes; maternal effect lethal), and paralyzed Unc (hIn1 homozygotes). Par phenotype is slightly leaky, but survivors are agametic. NMY-2::GFP is expressed in the germline and somatic gonad. Cross of JJ1473 and KK818. Unknown if unc-119(ed3) is still present or homozygous in background. Reference: Small LE & Dawes AT. Mol Biol Cell. 2017 Aug 1;28(16):2220-2231. |
| BC347 |
unc-54(s74) I. |
Paralyzed Rigid Unc. Muscle birefrigence normal. Muscle normal in EM. |
| CB1008 |
unc-54(e1008) I. |
Unc. Suppressed by sup-5 and sup-7. |
| CB1009 |
unc-54(e1009) I. |
Paralyzed Unc. Null allele. |
| CB1092 |
unc-54(e1092) I. |
Paralyzed Unc. Null allele. |
| CB1108 |
unc-54(e1108) I. |
Slow moving Unc. |
| CB1157 |
unc-54(e1157) I. |
Temperature sensitive. Unc. Recessive. Dominant Slow. |
| CB1168 |
unc-54(e1168) I. |
Paralyzed Unc. Null allele. |
| CB1201 |
unc-54(e1201) I. |
Paralyzed Unc. Null allele. |
| CB1258 |
unc-54(e1258) I. |
Paralyzed Unc. Null allele. |
| CB1300 |
unc-54(e1300) I. |
Unc. Suppressed by sup-5 and sup-7. Null allele? Milder than most null. |
| CB1301 |
unc-54(e1301) I. |
Temperature sensitive Unc. |
| CB1315 |
unc-54(e1315) I. |
Paralyzed Unc. Severe phenotype. Recessive. Null allele. |
| CB1419 |
unc-54(e1419) I. |
Unc. Suppressed by sup-5 and sup-7. |
| CB190 |
unc-54(e190) I. |
Semi-paralyzed Unc. Null allele. Recessive. M-MATING-NO SUCCESS. |
| CB2203 |
unc-54(e190) I; dpy-11(e224) eDp22 V. |
Dpy. Movement Slow. Unc partially suppressed. |
| CB2204 |
unc-54(e190) I; eDp22 V. |
Movement slow. Unc partially suppressed. |
| CB2221 |
unc-54(e1315) I; dpy-11(e224) eDp23 V. |
Dpy. Movement Slow. Unc partially suppressed. |
| CB2779 |
let-201(e1716) unc-54(e1092)/eDf24 I. |
Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000). |
| CB2780 |
let-203(e1717) unc-54(e1092)/eDf24 I. |
Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000). |
| CB2781 |
unc-54(e1092) let-208(e1718)/eDf24 I. |
Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000). |
| CB2782 |
let-204(e1719) unc-54(e1092)/eDf24 I. |
Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000). |
| CB2784 |
let-202(e1720) unc-54(e1092)/eDf24 I. |
Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000). |
| CB2785 |
let-206(e1721) unc-54(e1092)/eDf24 I. |
Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000). |
| CB2786 |
let-205(e1722) unc-54(e1092)/eDf24 I. |
Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000). |
| CB2787 |
let-207(e1723) unc-54(e1092)/eDf24 I. |
Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000). |
| CB3019 |
unc-54(e1258) I; eDf1 eDp21/+ V. |
Movement slow. Suppressed Unc. Revertant. Heterozygotes move slowly and segregate larval lethals (eDf1 eDp21 homozygotes), and paralyzed Uncs. |
| CB3035 |
unc-54(e1258) I; wdDp1 V. |
Suppressed Unc. |
| CB569 |
unc-54(e569) I. |
Paralyzed Unc. |
| CB576 |
unc-54(e576) I. |
Slow movement. |
| CB651 |
unc-54(e651) I. |
|
| CB675 |
unc-54(e675) I. |
Slow moving Unc. Semi-dominant. |
| CB843 |
unc-54(e843) I. |
Stiff. Body muscle abnormal. |
| CGC58 |
C54E10.3(umn2[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. |
Homozygous viable. Deletion of 745 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tgtacccccgatgggattcgaacctgtggc ; Right flanking sequence: gggtatgcaaaatgaccgcgttttctgtga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| CGC59 |
gnrr-7(umn3[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. |
Homozygous viable. Deletion of 1004 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttgttctggtttaaagccgcaaagtcttgg ; Right flanking sequence: agggtaccatcaagcaatggcattctggtt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| CGC61 |
F36D4.4(umn4[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. |
Homozygous viable. Deletion of 917 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CATGTACTCCCCTATATCTTCCAAACATTC ; Right flanking sequence: TGGACATCTTGGAGCACTTTCTGTGATTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| CGC72 |
npr-23(umn5[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. |
Homozygous viable. Deletion of 280 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAGGCGTCATCTGGAGAGAAGAACGAAgtg ; Right flanking sequence: CGGACACTTGTGCTTCACCAACTTGATCGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| CGC73 |
npr-28(umn6[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. |
Homozygous viable. Deletion of 842 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TATTTGGTATCATTTTTCTAGCCGACTTTC ; Right flanking sequence: TGGACTTGTTTTCACTCATCCCTGTACCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| CGC78 |
C04C3.6(umn8[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. |
Homozygous viable. Deletion of 1123 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aaaaatcaactatttttaatgaaaatttca ; Right flanking sequence: TGGTCACTTTACCTGCGTTGATATTCATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| CGC81 |
C09F12.3(umn9[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. |
Homozgous viable. Deletion of 1171 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: acaatttacattaacttttcattatttcag ; Right flanking sequence: tggatgtgcattttttcgctgctcactctt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| CL2006 |
dvIs2. |
dvIs2 [pCL12(unc-54/human Abeta peptide 1-42 minigene) + rol-6(su1006)]. Temperature-sensitive. Maintain at 15C. Adult onset paralysis and egg-laying deficiency when raised at 20C. A few animals will be paralyzed even at permissive temperatures. Received new stock from CL 8/2005. |
| CL2122 |
dvIs15. |
dvIs15 [(pPD30.38) unc-54(vector) + (pCL26) mtl-2::GFP]. Control strain for CL2120. Phenotype apparently WT. |
| CZ3086 |
kin-1(ok338)/unc-54(r293) I. |
Heterozygotes are WT and segregate WT, Unc, and early larval lethal. |
| DR115 |
unc-15(e73) unc-54(e675) I. |
Slow movement. |
| DR119 |
unc-54(e1258) I; dpy-11(e224) wdDp1 V. |
DPY. |
| DR120 |
unc-54(e1258) I; eDp23 V. |
|
| DR176 |
unc-54(e190) I; eDp23 V. |
Suppressed-movement slow. Unlinked double. |
| DR177 |
unc-54(e1258) I; eDp22 V. |
Suppressed-movement slow. |