Gene Information: unc-42

Nameunc-42 View on WormBase
Species C. elegans
SequenceF58E6.10
Genetic positionV:2.17 +/- 0.007 cM
Genomic positionV: 9764534..9769391

Strains carrying this gene

Strain Genotype Description
RG3055 rpl-4(ve555[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; +/hT1 [unc-42(e270)] V. umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygous lethal, heterozygous animals might grow slower than wild-type. Deletion of 1188 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type mKate2+GFP+, and segregate wild-type mKate2+GFP+, arrested GFP+ non-mKate2 (rpl-4 homozygotes), arrested non-GFP mKate2+ (hT1 homozygotes), and dead eggs. Maintain by picking wild-type mKate2+ and GFP+. Left flanking Sequence: ATTTCTTCACGTTGGCCTTTGAAGCCTTGC ; Right flanking sequence: Ttattacctgcaatcaacagaaatagtaaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3060 B0261.1(ve560[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; +/hT1 [unc-42(e270)] V. umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygous Let. Deletion of 4055 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain PD1074. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve560 homozygotes),  non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs. Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: AATGCACAATTTGCATCTCCAAATCCGCCA ; Right flanking sequence: ccgttattttacgactgtcaaatctccatt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3067 +/hT1 [umnIs58] I; erfa-1(ve567[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [unc-42(e270)] V. umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygous larval arrest. Deletion of 2016 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve567 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs. Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: cagcacaaatagaatATGAGCGCTCCCGCA ; Right flanking sequence: GGTGGATGTTTCTACTCGCAATTCCAATGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3071 mlt-2(ve571[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; + /hT1 [unc-42(e270)] V. umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygous Let. Deletion of 2897 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 dead larvae (ve571 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs. Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: gttttcattaaatcaaaatttgtgccacca ; Right flanking sequence: GCAAACCGTCGATctttaagattgtaacat. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3086 +/hT1 [umnIs58] I; cmd-1(ve586[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [unc-42(e270)] V. umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygous larval arrest. Deletion of 1416 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve586 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: gattttttctctctcgtcaccgtttcaccc ; Right flanking sequence: acctgtaaaaccccataaaaaaatttaaaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3087 dad-1(ve587[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; + /hT1 [unc-42(e270)] V. umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygous larval arrest. Deletion of 699 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve587 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: gtgtaacacagcaagagaaacgaaacccca ; Right flanking sequence: TTTGGTAGTCATCGAACAGTTTCGAGAGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3105 nduf-6(ve605[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; +/hT1 [unc-42(e270)] V. umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygous late larval arrest. Deletion of 560 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve605 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: gctcttttatattgaattcaaagttgtatc ; Right flanking sequence: tggttttattttttagtatgtatacaaaac. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3111 F56C11.5(ve611[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; +/hT1 [unc-42(e270)] V. umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygous Mel. Deletion of 3345 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 adults that lay dead eggs (ve611 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: GATCAATCGCTGGTCCAGAAGGTTCCACTA ; Right flanking sequence: TCAGGCCACCGATTTTTAGtctatatttta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3112 gcsh-2(ve612[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; +/hT1 [unc-42(e270)] V. umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygous sterile. Deletion of 773 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 sterile adults (ve612 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: CATACTGTTCCTCGTTAAGAAGTTTTTCCA ; Right flanking sequence: agggcaatgattgtcttggagttttttttg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3127 rpt-5(ve627[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; +/hT1 [unc-42(e270)] V. umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Larval lethal w/ escapers that show pleiotropic phenotypes. Deletion of 1521 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae with occasional escapers (ve627 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: gattcaaagggaacacagtgacaaccggga ; Right flanking sequence: tctggggcctgaaaattagttgtaattgct. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3139 pigv-1(ve639[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1[umnIs58] I; +/hT1[unc-42(e270)] V. umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygous sterile. Deletion of 2451 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 sterile adults (ve639 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: tattgatctgttttctaaaatgattaatac ; Right flanking sequence: cattaattaatttccttatccgtttaacta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3140 +/hT1[umnIs58] I; T10B5.3(ve640[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1[unc-42(e270)] V. umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygous larval lethal. Deletion of 2913 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve640 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: gatattatgatattagagagacggcgggga ; Right flanking sequence: tctggaaactgcaaaaaaatattggaaaat. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3223 sec-11(ve723[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; +/hT1 [unc-42(e270)] V. umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygotes are sick, Egl. Deletion of 2571 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 sick, Egl adults (ve723 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: AGTTTTCCTTATGCAACAGGACGAAGAGAC ; Right flanking sequence: GAAGGAACTTCATctgaaatgggattatgc. sgRNA #1: GCAACAGGACGAAGAGACCG; sgRNA #2: TGAACATCGCAACATCGGGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
SL958 unc-42(e270) spe-42(eb5) V/nT1 [unc-?(n754) let-? qIs50] (IV;V). Heterozygotes are Unc and express myo-2::GFP in the pharynx. unc-42(e270) spe-42(eb5) homozygotes are Unc and non-GFP. Whle unc-42(e270) spe-42(eb5) self progeny have not been quantified, spe-42(eb5) alone produces 9 self progeny at 16C and <1 self progeny at 25C. The Spe defect can be rescued by WT sperm. Homozygous nT1[unc-?(n754) let-? qIs50] are embryonic lethal.
TY1312 unc-42(e270) yDf9 V/nT1 [let-?(m435)] (IV;V). Heterozygotes are WT and throw WT and dead eggs. yDf9 homozygotes arrest as dead eggs.
TY1702 unc-42(e270) yDf12 V/nT1 [unc-?(n754) let-?] (IV;V); dpy-6(e14) X. Heterozygotes are DpyUnc and segregate DpyUnc and dead eggs.
VC1444 unc-42(gk598) V. F58E6.10. External left primer: AAAGCGAAGCTCCTCCCTAC. External right primer: CCATCGAGGCAGTTCAAAAT. Internal left primer: GATCCGAAATTGGACGAAGA. Internal right primer: AAGGACGACGTCTGACAACC. Internal WT amplicon: 2097 bp. Deletion size: 1430 bp. Deletion left flank: TTTAGGATTGAACACACCAAGATCAGATCT. Deletion right flank: GTTAACGAAGAAATGTTTCCTAATTTTAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807