| VC10078 |
syd-1(gk802) unc-4(e120) II. |
F35D2.5. Unc. External left primer: TCAACGTTGTCGCTGATCTC. External right primer: CCTCAAATTCACGGAATGCT. External WT amplicon: 543 bp. This strain carries a point mutation in F35D2.5. The mutation is gk802, which is an A->T mutation at F35D2 coordinate 23221 (flanking sequences TCGACCAACTCACTAACTCTTGAGGGCCAT and TCGACAAAATCATTTGGAGACTTGAAGATG). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC10079 |
unc-4(e120) mix-1(gk803) II. |
M106.1. Unc. External left primer: GTTGAGGAAGCAGCTGGAAC. External right primer: TTCTTCGCAGCAGTAATCCC. External WT amplicon: 815 bp. This strain carries a point mutation in M106.1. The mutation is gk803, which is an A->G mutation at R06F6 coordinate 40587 (flanking sequences CACAAAATACCGTAATGACCTCGAATCCCT and ACGAGAGGAACAATTGCTAATGACAAAGGA). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC10109 |
K05F6(gk907) unc-4(e120) II. |
K05F6.2. Unc. External left primer: ACAAATTCCCTTTGTCGTCG. External right primer: TGGATGAGCAGCTGGTAAGA. External WT amplicon: 200 bp. This strain carries a point mutation in K05F6.2. The mutation is gk907, which is a T->A mutation at K05F6 coordinate 21364 (flanking sequences AAATCAAAAACTCTGTTTGATGGATATCTA and ATGCCTTTAAATGATCTACTTCTTACCAGC). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC10110 |
let-19(gk908) unc-4(e120) II. |
K08F8.6. Unc. External left primer: TCAATGCCTGGAGATGATGA. External right primer: CCCGCCTTCTTTATCTGTTG. External WT amplicon: 434 bp. This strain carries a point mutation in K08F8.6. The mutation is gk908, which is a G->A mutation at K08F8 coordinate 36647 (flanking sequences AATGGTTGAAGAAAGCAAGAAGGAAAGTTA and CAAACAACAGATAAAGAAGGCGGGGCAGTA). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC1453 |
unc-4(gk668) II. |
F26C11.2. Unc. External left primer: TTCATGGTGAGAACGAGCAG. External right primer: GGCATATGTACGAGGCAGGT. Internal left primer: CGCAAGGTGAAATGAGTGAA. Internal right primer: GCCGACACGCCTACTTTCTA. Internal WT amplicon: 2274 bp. Deletion size: 1602 bp. Deletion left flank: CGTTTCCGATCCATCGGATGGATTCAGGAG. Deletion right flank: AACTGGGAAATTGGATTTAAAAATTGAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC1528 |
unc-4(gk705) II. |
F26C11.2. Unc. External left primer: TTCATGGTGAGAACGAGCAG. External right primer: GGCATATGTACGAGGCAGGT. Internal left primer: CGCAAGGTGAAATGAGTGAA. Internal right primer: GCCGACACGCCTACTTTCTA. Internal WT amplicon: 2274 bp. Deletion size: 307 bp. Deletion left flank: TGCAAAGTATTTCACTACAGTTTTACTGTA. Deletion right flank: GCTTAATCCTGCTAGACTTCTACCACAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC206 |
fzy-1&cyp-44A1(ok312) unc-4(e120)/mIn1 [mIs14 dpy-10(e128)] II. |
ZK177.6, ZK177.5. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and GFP- hDf35 unc-4 homozygotes (larval/sterile adult arrest). Pick fertile GFP WT to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| WM170 |
unc-4(e120) pir-1(tm1496)/mnC1 [dpy-10(e128) unc-52(e444)] II. |
Heterozygotes are WT and segregate WT, DpyUncs, and Unc-4 animals which arrest at the L4 stage. Rarely, a recombination will occur and unc-4 and pir-1 will become unlinked. Propagate the strain by picking single WT animals and checking for correct segregation of progeny. 6/2007: Daniel Chavez notes that tm1496 may also delete part of sec-5, which could be responsible for the developmental arrest of tm1496. |
| WS841 |
ptp-2(op194) unc-4(e120)/mIn1 [dpy-10(e128)] II; him-5(e1490) V. |
Heterozygotes are WT and segregate WT, Uncs which are sterile (>10 offspring) and Dpys. Throws males of all classes. mIn1 pka mC6. |