Gene Information: unc-4

Nameunc-4 View on WormBase
Species C. elegans
SequenceF26C11.2
Genetic positionII:1.77 +/- 0.006 cM
Genomic positionII: 9897751..9900376

Strains carrying this gene

Strain Genotype Description
SP704 unc-4(e120) mnDf76/mnC1 [dpy-10(e128) unc-52(e444)] II. Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.
SP705 unc-4(e120) mnDf77/mnC1 [dpy-10(e128) unc-52(e444)] II. Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.
SP709 unc-4(e120) let-243(mn226)/mnC1 [dpy-10(e128) unc-52(e444)] II. Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.
SP710 let-264(mn227) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.
SP711 let-241(mn228) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.
SP713 let-238(mn229) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.
SP715 spe-3(mn230) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Hets are WT and segregate WT, paralysed DpyUnc and Sterile Unc-4's. spe-3 homozygotes lay self-fertilized eggs that do not hatch. Oocytes can be rescued by fertilization with mutant sperm from spe-3/+ males. Maintain by picking WT.
SP719 unc-4(e120) mnDf83/mnC1 [dpy-10(e128) unc-52(e444)] II. Hets are WT and segregate WT, DpyUnc and no viable Unc-4's. Maintain by picking WT.
SP720 unc-4(e120) mnDf84/mnC1 [dpy-10(e128) unc-52(e444)] II. Hets are WT and segregate WT, dead eggs and paralyzed DpyUnc. Maintain by picking WT.
SP726 unc-4(e120) let-248(mn237)/mnC1 [dpy-10(e128) unc-52(e444)] II. Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.
SP727 unc-4(e120) let-249(mn238)/mnC1 [dpy-10(e128) unc-52(e444)] II. Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.
SP728 unc-4(e120) mnDf85/mnC1 [dpy-10(e128) unc-52(e444)] II. Hets are WT and segregate WT, dead eggs and paralysed DpyUncs. Maintain by picking WT.
SP731 let-263(mn240) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.
SP752 unc-4(e120) mnDf86/mnC1 [dpy-10(e128) unc-52(e444)] II. Hets are WT and segregate WT, DpyUnc and kinker Uncs which arrest as early larvae. Maintain by picking WT.
SP753 unc-4(e120) mnDf87/mnC1 [dpy-10(e128) unc-52(e444)] II. Hets are WT and segregate WT, dead eggs and paralyzed DpyUnc. Maintain by picking WT.
SP754 unc-4(e120) mnDf88/mnC1 [dpy-10(e128) unc-52(e444)] II. Hets are WT and segregate WT, DpyUnc and no viable Unc-4's. Maintain by picking WT.
SP755 unc-4(e120) mnDf89/mnC1 [dpy-10(e128) unc-52(e444)] II. Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.
SP756 unc-4(e120) mnDf90/mnC1 [dpy-10(e128) unc-52(e444)] II. Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.
SP757 unc-4(e120) mnDf91/mnC1 [dpy-10(e128) unc-52(e444)] II. Hets are WT and segregate WT, dead eggs and paralysed DpyUnc. Maintain by picking WT.
SP758 unc-4(e120) mnDf92/mnC1 [dpy-10(e128) unc-52(e444)] II. Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.
SP759 unc-4(e120) mnDf93/mnC1 [dpy-10(e128) unc-52(e444)] II. Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.
SP760 unc-4(e120) mnDf94/mnC1 [dpy-10(e128) unc-52(e444)] II. Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.
SP781 unc-4(e120) mnDf97/mnC1 [dpy-10(e128) unc-52(e444)] II. Hets are WT and segregate WT, dead eggs and DpyUnc. Maintain by picking WT. [2/97: This strain also throws Dpys. RK Herman put a new mnC1 dpy-10 unc-52 chromosome into the strains, and it still continues to throw Dpys. It seems that the mnC1 dpy-10 unc-52 chromosome is correct. It's possible that the mnDf97 chromosome is broken.]
SP782 unc-4(e120) mnDf98/mnC1 [dpy-10(e128) unc-52(e444)] II. Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.
SP783 unc-4(e120) mnDf99/mnC1 [dpy-10(e128) unc-52(e444)] II. Hets are WT and segregate WT, DpyUnc and no viable Unc-4's. Maintain by picking WT.
SP784 unc-4(e120) mnDf100/mnC1 [dpy-10(e128) unc-52(e444)] II. Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.
SP787 unc-4(e120) mnDf95/mnC1 [dpy-10(e128) unc-52(e444)] II.
SP788 unc-4(e120) mnDf96/mnC1 [dpy-10(e128) unc-52(e444)] II. Hets are Dpy and segregate Dpy, dead eggs and paralysed DpyUnc. Maintain by picking Dpy.
SP789 unc-4(e120) mnDf101/mnC1 [dpy-10(e128) unc-52(e444)] II. Hets are WT and segregate WT, paralysed DpyUnc and Unc-4 lethals that arrest at L2. Maintain by picking WT.
SP790 unc-4(e120) mnDf103/mnC1 [dpy-10(e128) unc-52(e444)] II. Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.
SP802 unc-4(e120) mnDf104/mnC1 [dpy-10(e128) unc-52(e444)] II. Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.
SP803 unc-4(e120) mnDf105/mnC1 [dpy-10(e128) unc-52(e444)] II. Hets are WT and segregate WT, DpyUnc and no viable Unc-4's. Maintain by picking WT.
SP804 unc-4(e120) mnDf106/mnC1 [dpy-10(e128) unc-52(e444)] II. Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.
SP806 unc-4(e120) mnDf108/mnC1 [dpy-10(e128) unc-52(e444)] II. Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.
SP807 unc-4(e120) mnDf109/mnC1 [dpy-10(e128) unc-52(e444)] II. Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT. [12/93 **mnC1 appears to have broken down**]
SS186 mes-2(bn11) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Heterozygotes are WT and segregate WT, DpyUnc and Uncs which give sterile progeny (maternal effect sterile: the progeny from mutant mothers are sterile). The mutation is a strict mel, fully penetrant, and fully expressed. Sterility is due to a failure in germ-cell proliferation.
TJ1047 unc-4(e120) emb-27(g48) II. Unc. Temperature sensitive. Maintain at 15C.
TJ415 age-1(hx546) rrf-3(b26) unc-4(e120) II. Long lived (1.4X CB120). Low brood size. Unc. Temperature sensitive sperm defect. Maintain at 15C.
TY2788 unc-4(e120) II; yDf19/yDf20 X. yDf20 previously known as y288. Internal deletion. Takes out dpy-3 and lin-32. Heterozygotes are Unc.
VC10002 bli-2(e768) F10E7.2&spon-1&F10E7.11(gk460) unc-4(e120)/mIn1 [mIs14 dpy-10(e128)] II. F10E7.2, F10E7.4, F10E7.11. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and Unc non-GFP gk460 homozygotes (probable embryonic arrest; bli-2 not evident until adult stage). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AACAATGTTTGGTCCATCCC. External right primer: ACACCAGGTTGACCTCCTTG. Internal left primer: ATGAGCCCAAATGAACCAAC. Internal right primer: AATAGGCACAATACGCCTGC. Internal WT PCR product: 5051. Deletion size: 4507 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10005 ast-1(gk463) bli-2(e768) unc-4(e120)/mIn1 [mIs14 dpy-10(e128)] II. T08H4.3. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and Unc non-GFP gk463 homozygotes (larval arrest; bli-2 not evident until adult stage). Pick WT dim GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10007 bli-2(e768) C06A8.1(gk465) unc-4(e120)/mIn1 [mIs14 dpy-10(e128)] II. C06A8.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and Unc non-GFP gk465 homozygotes (larval arrest; bli-2 not evident until adult stage). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: ACTGCAATCGGAGTGGTTTC. External right primer: GGGAATCATGCCAATTATGG. Internal left primer: GGTCATGAAGCATTCGAGGT. Internal right primer: GAACAGAGCGTTGCATTGAA. Internal WT PCR product: 718. Deletion size: 141 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10067 F31D5.1(gk770) gkDf13 unc-4(e120) II. This strain is homozygous for two deletions plus unc-4(e120). The deletions were identified by comparative genome hybridization (CGH) of a mutangenized unc-4 line against N2. The deletion gk770 was confirmed by PCR and sequencing of the amplification product, and is detectable using the following primers. Left primer: GCGCATTTGCAACATCTCTA. Right primer: AACCTCAACGGAAACACTGG. WT amplicon: 1087 bp. Deletion size: 142 bp. Deletion left flank: CAGGTGAGCTTAAGCAGATTTTTTTTTGAA. Deletion right flank: GTGAGCCAAGTTAAACATTTGAAAATAATT. Insertion Sequence: GTGAGCCAAGTTGAACATTTGAAAATAAT. The deletion gkDf13 was not confirmed by PCR. CGH data indicates a maximum size of 7801 bp and a minimum size of 1357 bp. Left flanking probe: GTTTTATCTTTCGGCTTATTCAGAATAAATTATTGGTTCAGTTGTTTCAG. Left deleted probe: AGGAGAAGGAGATAAATGGTCTTGTAGACTGCGCAGCTAGGGAGAGAGAA. Right deleted probe: GAAGTTCTGAAGATTCAATTTTCAGTCTTACAATATTCAGTTCTCGTGTA. Right flanking probe: GTTGAATTTATTCGAATTTTGCAATTTCAGCAAAACACCTTTATCTTGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10068 unc-4(e120) sre-29(gk771) II. F57G9.4. Unc. External left primer: GACCTGAAATTGCTGGGAAA. External right primer: GGAAACTCACAAATTGCCGT. External WT amplicon: 1532 bp. Deletion size: 161 bp. Deletion left flank: CCCTCTCCACCGCAATTGCAAGAACTCCAA. Deletion right flank: GCTATAGTAATCAATTTTCCAATTATAAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10070 K05F1(gk773) unc-4(e120) II. K05F1. Unc. External left primer: GTATGGTCCGTCGCAAGAAT. External right primer: CTGATGACGGTTTTCCTGGT. External WT amplicon: 1653 bp. Deletion size: 490 bp. Deletion left flank: CCGCCAAATTTGGCGGTTTCTGAGACCTTG. Deletion right flank: CTCGCATACGCTTGAAACTTACAGCGTTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10071 srb-16(gk774) unc-4(e120) II. F58A6.6. Unc. External left primer: AAGTGGTTTTGGGTCTGACG. External right primer: GTACCGCCGCAAGAATGTAT. Internal left primer: GCCGCCACGAGTTAATAGAA. Internal right primer: TGTTGGCCCTGATTTCTTTC. Internal WT amplicon: 4857 bp. Deletion size: 3522 bp. Deletion left flank: ACGATTTTTGCACAAAAAACCCCTCCAAAC. Deletion right flank: GTCGTTTGCTTGTTTCATCTTCATCATTGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10072 cpna-2(gk775) unc-4(e120) II. B0228.4. Unc. External left primer: GCTCAAAGCTCCGAAACAAC. External right primer: CCCACAAGATTGGTAAGCGT. External WT amplicon: 876 bp. Deletion size: 153 bp. Deletion left flank: AGTTAGACACACTGAAAATGCTGGAAAGGT. Deletion right flank: CAGAAGCCTTGCTCCGTCGGCATCTGAGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10073 T28D9(gk776) unc-4(e120) II. T28D9. Unc. External left primer: CATTTCGGAACGTTTCCATC. External right primer: TCTGCTTCGTACTTTGCTGC. External WT amplicon: 1121 bp. Deletion size: 436 bp. Deletion left flank: TTTTTTACGTGAATCTTTTTTTTTTCAGAA. Deletion right flank: CAAGTTGTGAATTTTCGAACATCCGTCGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10075 T05A6.4(gk777) unc-4(e120) II. T05A6.4. Unc. External left primer: GCAATCCTTCAAGTTCCCAA. External right primer: ACGACTTGCAGATGGTTGTG. External WT amplicon: 902 bp. Deletion size: 140 bp. Deletion left flank: GGGCATGTAAAAGTGTGCTTGTCTTTCATA. Deletion right flank: TACCACCATTTTTTTTTCATTTTTGGATGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10077 unc-4(e120) Y46E12BL.2(gk801gk909) II. Y46E12BL.2. Unc. External left primer: ATCCACAATGCTCCGATCTC. External right primer: TCTGGCTTGCTTTTGTGATG. External WT amplicon: 540 bp. This strain contains two point mutations in Y46E12BL.2. The first is gk801, which is a G->A mutation at Y46E12BL coordinate 21938 (flanking sequences GTTCTTGAAGCTATACGGCTTTACACAGAA and TTACTCCAGCCGATCTGGTCACCCGTTATG). The second is gk909, which is an A->G mutation at Y46E12BL coordinate 21966 (flanking sequences AAGTTACTCCAGCCGATCTGGTCACCCGTT and TGTCGATAGTGCGATCGCCAAGTCCAAGGA). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807