Gene Information: bli-4

Namebli-4 View on WormBase
Species C. elegans
SequenceK04F10.4
Genetic positionI:1.02 +/- 0.002 cM
Genomic positionI: 6342224..6356680

Strains carrying this gene

Strain Genotype Description
JK3361 qIs76 I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). qIs76 [tra-1::GFP::beta-GAL + rol-6(su1006)]. Rollers express TRA-1::GFP in Z1/Z4, intestine, etc. qIs76 homozygotes are lethal. Heterozygotes are Rol GFP+ (pharynx). Pick Rollers with GFP+ pharynx to maintain. Reference: Chang W., et al. Development. 2004 Mar;131(6):1425-36.
JK3501 pop-1(q772) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Heterozygotes are WT and GFP+. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. q772 is embryonic lethal.
JK3743 fog-1(q785) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Heterozygotes are WT and GFP+. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK3934 gld-1(q93) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I; III). Heterozygotes are WT, GFP+ in the pharynx and segregate WT (GFP+ in the pharynx), dead eggs (hT2 homozygotes) and non-GFP gld-1(q93) homozygotes with masculinized germlines. Some heterozygotes will also have a masculinized germline. Maintain by picking GFP worms and checking for correct segregation, since the hT2 balancer is lost at low frequencies. gld-1(q93) was isolated as a dominant suppressor of fem-1(hc17).
JK4087 rnp-8(q784) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Heterozygotes are WT and GFP+. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. rnp-8 homozyotes are GFP- and look like WT. Slow L4 to Adult transition.
JK4299 gld-2(q497) gld-1(q361) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Pick GFP+ heterozygotes to maintain. Segregates fertile GFP+ heterozygotes, non-GFP homozygous mutants (Gld; form germline tumors), very rare GFP+ homozygous hT2, and dead eggs. gld-1(q361) is a missense allele but phenotypically null, which allows the detection of gld-1 mRNA and protein by single molecule FISH or antibody staining. Reference: Hansen et al (2004) Dev. Biol. 2004;268(2):342-57. Shin et al. (2017) PLoS Genet. 2017;13(12):e1007121.
JK4307 rnp-8(tm2435) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Heterozygotes are WT and GFP+. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. PCR using 3 primers: primer A: TCA GCC GAC AAT CTC CGA; primer B: GTA CTG ATT GTA TCC ACC GGC; primer C: GCT CAT AGA AAA GCG ATG G. WT band = 0.5 kb; heterozygote bands = 0.8 and 0.5 kb (double bands), tm2435 bands = 0.8 kb.
JK4563 gld-1(q126) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Segregates WT GFP+ heterozygotes, non-GFP sterile gld-1 homozygotes, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK4774 lst-1(ok814) sygl-1(tm5040) I/hT2[bli-4(e937) let-?(q782) qIs48] (I;III). Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Kershner AM, et al. Proc Natl Acad Sci U S A. 2014 Mar 11;111(10):3739-44.
JK4832 gld-1(q485) gld-2(q497) lst-1(ok814) sygl-1(tm5040) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Pick GFP+ heterozygotes to maintain. Segregates fertile GFP+ heterozygotes, non-GFP homozygous mutants (Gld; form germline tumors), very rare GFP+ homozygous hT2, and dead eggs. Reference: Kershner et al. (2014) PNAS 111: 3739-3744.
JK4862 glp-1(q46) III/hT2[bli-4(e937) let-?(q782) qIs48] (I;III). Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Austin J & Kimble J. Cell. 1987 Nov 20;51(4):589-99.
JK5657 tra-1(q183) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I; III). Maintain at 15C. Heterozygotes are WT, GFP+ in the pharynx and segregate WT (GFP+ in the pharynx), dead eggs (hT2 homozygotes) and non-GFP tra-1(q183) homozygous females. Raise strain at 15C; at 20C many heterozygotes are also feminized. tra-1(q183) is temperature-sensitive for its XX, but not its XO mutant phenotype. At 25C, both q183/q183 and q183/+ are female. At 15C, q183/q183 is still always female, but q183/+ can be hermaphroditic. Maintain by picking fertile GFP worms and checking for correct segregation, since the hT2 balancer is lost at low frequencies.
JK5760 lst-1(ok814) sygl-1(q828) gld-2(q497) gld-1(q361) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Pick GFP+ heterozygotes to maintain. Segregates fertile GFP+ heterozygotes, non-GFP homozygous mutants (Gld; form germline tumors), very rare GFP+ homozygous hT2, and dead eggs. Reference: Shin et al. (2017) PLoS Genet. 2017;13(12):e1007121.
JK5943 qSi369 II; glp-1(q224) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); qSi370 V. qSi369 [sygl-1p::24xMS2 loops::3xflag::sygl-1::sygl1 3'UTR]. qSi370 [mex-5p:: MS2 Coat Protein::linker::sfGFP::tbb-2 3' UTR::gpd-2 intergenic sequence::H2B::mCherry::unc-54 3' UTR]. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP+ heterozygotes, non-GFP pharynx q224 homozygotes (Glp sterile at 20-25C) and dead eggs (hT2 homozygotes). All animals are sfGFP + in the germline, with distal and proximal transcription sites in the nucleus. qSi369 and qSi370 constitute an MS2 system which allows live visualization of sygl-1 nascent transcripts in the C. elegans germline in a glp-1 mutant background. Reference: Lee C, et al. Dev Cell. 2019 Aug 19;50(4):426-435.e4.
JN215 iff-1(tm483) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Segregates GFP+ glowing heterozygotes and non-glowing sterile iff-1 homozygotes. tm483 is a UV/TMP-induced iff-1 deletion allele generated by K. Gengyo-Ando and S. Mitani. hT2[qIs48] homozygotes inviable. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.
JS604 dpy-17(e164) tlk-1(tm2395) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and Dpy Stu homozygotes that are non-GFP. Homozygous hT2[bli-4 let-? qIs48] inviable.
KB4 glh-4(gk225) glh-1(ok439) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Pick GFP+ to maintain balanced stock. Heterozygotes are superficially wild-type GFP+ and segregate wild-type GFP+ (heterozygotes), arrested hT2 aneuploids, and non-GFP glh-4 glh-1 homozygotes (sterile; incompletely penetrant). NOTE (K. Bennett, 2012): KB4 strain is only 63% sterile at 20C and 92% sterile at 26C (Spike et al., Genetics 2008 178:1973). glh-1(ok439) is not a null allele.
KR1234 hT2 [bli-4(e937)] (I;III).
KR1557 hDf10 dpy-5(e61) unc-29(e403)/hT2 [dpy-18(h662)] I; +/hT2 [bli-4(e937)] III. Wild-type to mildly long phenotype, sometimes a bit Unc. Segregates wild-type, Dpy-18 (hT2[dpy-18 bli-4] homozygotes), hDf10 dpy-5 unc-29 homozygotes (probably dead eggs) and large numbers of aneuploids (dead eggs). dpy-18(h662) completely suppresses bli-4(e937), is only very mildly Dpy, and has a distinctive dark body and large clear vulval region as a young adult, before becoming gravid. Do not passage: hT2 homozygotes seem somewhat healthier than the het, and will overgrow the plate. Pick longish wild-types and check for correct segregation of progeny to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.
KR2467 dpy-5(e61)/hT2 I; unc-36(e251)/hT2 [bli-4(e937) let-?(h661)] III. Heterozygotes are WT and segregate WT, DpyUnc, lethal hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Maintain by picking WT. [March 1995: Apparently the lethal mutation is not in the balanced region. It occasionally crosses off and the strain starts giving Bli-4 hT2 homozygotes again. From Mark Edgley.] This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.
KW2090 cdk-9(tm2884) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Segregates WT green-glowing heterozygotes and non-glowing cdk-9 homozygotes (arrest as L1-L2 larvae). qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Reference: Bowman EA, et al. Development. (In Press).
KW2181 cdk-9(tm2884) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); ckSi12 II. ckSi12 [cdk-9(D235N)::mCherry + unc-119(+)] II. Segregates WT green-glowing heterozygotes and non-glowing cdk-9 homozygotes (arrest as L1-L2 larvae). qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Reference: Bowman EA, et al. Development. (In Press).
KW2205 cdk-9(tm2884) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); ckSi21 II. ckSi21 [cdk-9::mCherry::pal-1 3'UTR + unc-119(+)] II. mCherry is expressed in all somatic nuclei; expressed in germline only at end of oogenesis. hT2 segregates WT green-glowing heterozygotes and non-GFP cdk-9 homozygotes (normally arrest as L1-L2 larvae; cdk-9 homozygotes carrying ckSi21 (GFP- mCherry+) are viable but sterile. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Reference: Bowman EA, et al. Development. (In Press).
LE1923 fli-1(tm362) III/hT2 [bli-4(e937) let-?(q782)] (I;III). Sterile. Gonad & rachis defects. Grow at 20 C.
LM99 smn-1(ok355) I/hT2 [bli-4(e937) qIs48] (I;III). C41G7.1. smn-1 homozygotes arrest as larvae. Segregates WT glowing hets, non-glowing arrested larvae, very rare homozygous hT2 glowing animals, and dead eggs (aneuploids). URL: http://www.celeganskoconsortium.omrf.org.
LW905 lmn-1(tm1502) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP tm1502 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.
MLC2230 vha-1(luc161) III/hT2[bli-4(e937) let-?(q782) qIs48] (I;III). Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP, arrested hT2 aneuploids, and non-GFP luc161 homozygotes (embryonic lethal). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick wild-type GFP and check for correct segregation of progeny to maintain. vha-1(luc161) is a 454 bp deletion removing most of the coding sequence. Reference: Gutiérrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.
MT10996 sqv-5(n3611)/hT2 I; +/hT2 [bli-4(e937) let-?(h661)] III. Heterozygotes are WT and segregate WT, Sqv Mel, and dead eggs.
MT13516 isw-1(n4066) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP n4066 homozygotes (sterile). n4066 is a deletion of F37A4.8.
MT14171 met-1(n4337) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); met-2(n4256) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). n4256 is a deletion of R05D3.11 (met-2). n4337 is a deletion of C43E11.3 from the splice donor for the 4th exon through exon 7. Heterozygotes are WT with pharyngeal GFP signal. Homozygous hT2[bli-4 let-? qIs48] are inviable.
MT14728 mfap-1(n4564 n5214) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP mfap-1 homozygotes. Pick WT GFP and check for correct segregation of progeny to maintain. mfap-1(n4564 n5214) mutants exhibit temperature-sensitive lethality: at 15°C, (n4564 n5214) homozygous animals grow and behave similarly to wild-type; at 20°C mutant animals grow more slowly, have few progeny and are hyperactive; at 25°C the mutant strain is embryonically lethal. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Reference: Ma L, et al. PLoS Genet. 2012;8(7):e1002827.
MT15080 sup-17(n1306) unc-29(e1072) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Heterozygotes are WT and GFP+. hT2[qIs48] animals are recessive lethal. n1306 is recessive late larval lethal. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.
MT15081 sup-17(n1315) unc-29(e1072) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Heterozygotes are WT and GFP+. hT2[qIs48] animals are recessive lethal. n1315 is recessive lethal. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.
MT15082 sup-17(n1318) unc-29(e1072) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Heterozygotes are WT and GFP+. hT2[qIs48] animals are recessive lethal. n1318 is recessive lethal. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.
MT15083 sup-17(n1319) unc-29(e1072) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Heterozygotes are WT and GFP+. hT2[qIs48] animals are recessive lethal. n1319 is recessive lethal. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.
MT15084 sup-17(n1320) unc-29(e1072) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Heterozygotes are WT and GFP+. hT2[qIs48] animals are recessive lethal. n1320 is recessive lethal. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.
MT15107 lin-53(n3368) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Homozygous lethal deletion balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP n3368 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.Class B SynMuv, Ste, Pvul. Reference: Harrison MM, Ceol CJ, Lu X, Horvitz HR. PNAS. 2006 Nov 7;103(45):16782-7.
MT15606 met-2(n4256) hpl-2(tm1489) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Heterozygotes are WT and GFP+. qIs48 [myo-2::GFP + pes-10::GFP + ges-1::GFP]. Homozygous hT2 animals are inviable. May have lin-15A(n767) in background.
MT19085 hlh-2(n5287) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP n5287 homozygotes (embryonic lethal). Homozygous hT2 [bli-4 let-? qIs48] inviable. Pick wild-type GFP and check for correct segregation of progeny to maintain. n5287 is a 2,694 bp deletion (flanking seq 5' - TGCAACTGCCGCCATTGCTC 3' - AAAACTCTCTAGCATATTGT) and 25 bp insertion (TCTGCCATCATTGCTGCCATTGCTC). Reference: Nakano S, Ellis RE, Horvitz HR. Development. 2010 Dec;137(23):4017-27.
MT20187 rba-1(n5418) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Pick wild-type GFP+ to maintain. Heterozygotes are wild-type GFP+ and segregate WT green-glowing heterozygotes and non-glowing rba-1 homozygotes. rba-1(n5418) homozygotes are sterile or produce eggs that fail to hatch. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Reference: Nakano S, Stillman B, Horvitz HR. Cell. 2011 December 23; 147(7): 1525-1536.
MT20434 chaf-1(n5453) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Heterozygotes are WT and GFP+ in the pharynx. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Presence of ces-1 is inferred from strain construction but not experimentally verified. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Reference: Nakano S, et al. Cell. 2011 Dec 23;147(7):1525-36.
MT3248 bli-4(e937) sem-4(n1378) I.
MT4552 unc-74(e883) bli-4(e937) unc-87(e1459) I. Blistered Uncs.
MT9647 unc-29(e1072) sqv-5(n3039)/hT2 I; +/hT2 [bli-4(e937) let-?(h661)] III. Heterozygotes are WT and segregate WT, UncSqv and dead eggs. n3039: mid-L4 vulva abnormal, sterile.
NF1226 mig-22(tk69) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). mig-22(tk69): DTC migration defect and maternal effect embryonic lethal. Heterozygotes are WT with pharyngeal GFP signal. Homozygous hT2[bli-4 let-? qIs48] are inviable.
NM2040 dhc-1(js121) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); jsIs37 V. jsIs37 [mec-7p::snb-1::GFP) + lin-15(+)]. snb-1::GFP expression in a subset of mechanosensory neurons; GFP is faint and can only be seen on a compound microscope. Heterozygotes are GFP+ in the pharynx. dhc-1 homozygotes are GFP- and sterile or partially sterile pvuls. Homozygous sterile mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP js121 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.
OC271 pph-4.1(tm1598) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Homozygous sterile mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP tm1598 homozygotes (produce ~100% dead eggs, slightly higher penetrance at 25C). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Peters N, et al., J Cell Sci. 2010 Mar 1;123(Pt 5):795-805.
OG575 hsf-1(ok600) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); drSi13 II. drSi13 [hsf-1p::hsf-1::GFP::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses single-copy drSi13 in the background of balanced hsf-1(ok600). drSi13 includes hsf-1 cDNA with a C-terminal GFP and controlled by 4 kb of the hsf-1 promoter, integrated at a single copy by MosSCI on chromosome II at ttTi5605. Segregates WT GFP+ heterozygotes, non-GFP rescued ok600; drSi13 homozygotes, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.
OG576 hsf-1(ok600) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Segregates WT GFP+ heterozygotes, larval-arrested ok600 homozygotes, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+. [NOTE: Although ok600 has been reported as a 1085 bp deletion in hsf-1, sequencing of the hsf-1 PCR product revealed only an 877 bp deletion (5'-AAATAAAAATTTCTTAGAAA [877 bp deletion] TGTACATGGGATCCGGTCCA-3'). (Lamitina Lab, 12/17/2012)]
OG584 hsf-1(ok600) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); drSi28 II. drSi28 [hsf-1p::hsf-1(R145A)::GFP::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses single-copy drSi28 in the background of balanced hsf-1(ok600). drSi28 includes hsf-1 cDNA containing an arginine to alanine mutation at residue 145 in the DNA binding domain with a C-terminal GFP and controlled by 4 kb of the hsf-1 promoter, integrated at a single copy by MosSCI on chromosome II at ttTi5605. Segregates WT GFP+ heterozygotes, non-GFP ok600 homozygotes (not rescued by drSi28), very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.