Gene Information: dpy-10

Namedpy-10 View on WormBase
Species C. elegans
SequenceT14B4.7
Genetic positionII:0.00 +/- 0.000 cM
Genomic positionII: 6710149..6712227

Strains carrying this gene

Strain Genotype Description
VC1242 +/mT1 II; cup-5(ok1698)/mT1 [dpy-10(e128)] III. R13A5.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1698 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CCAGCCCGAAATTTTTGTAA. External right primer: CCGTAATATGTGTTGCAGCG. Internal left primer: CGTGTCTCTAGCTTCCCTGC. Internal right primer: ATCTACGTGCATTCGCACTG. Internal WT amplicon: 2867 bp. Deletion size: 1546 bp. Deletion left flank: TGCTTCTTCAAATGCTTCTCGAAGGCCAAC. Deletion right flank: ATTGTGGTCAACGATGCGCTTATTATCATT. Insertion Sequence: GTGGTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1249 +/mT1 II; ula-1(ok1700)/mT1 [dpy-10(e128)] III. C26E6.8. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1700 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GGGTTTCCGGGGATATCTAA. External right primer: CGTACTGCCTGCATGAGAAA. Internal left primer: ATGTCATGCCACAAGGAACA. Internal right primer: CATTCTTGTGAAACTCGCCA. Internal WT amplicon: 2184 bp. Deletion size: 930 bp. Deletion left flank: GAATGTTGCCGACTCCTGAGTATGTCCATC. Deletion right flank: GAACGTCGGAAACTCATAAGAATCGCCTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1261 +/mT1 II; C36E8.1(ok1714)/mT1 [dpy-10(e128)] III. C36E8.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1714 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CTGAGGATCCACCCATCATC. External right primer: GAAGCTTGAAGAAGAGGCGA. Internal left primer: TGGAGTCATGAACTTGCTGC. Internal right primer: GAAACTTTCGAGCAATGGGA. Internal WT amplicon: 3294 bp. Deletion size: 833 bp. Deletion left flank: ACATTCTAGAAATGTGTCAAAAAGCTTCTC. Deletion right flank: TTTCAAAATGCTCATTTTGAACTTTTTCTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1274 H20J04.6(ok1739)/mIn1 [mIs14 dpy-10(e128)] II. H20J04.6. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1739 homozygotes (slow-growing, sickly, mostly sterile). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CCCGGAGCATGAAATTCTTA. External right primer: AATGGAGCTCGAAAATGTGG. Internal left primer: TCCAACGCACAATTGAAAAA. Internal right primer: TCCAGCAAAATATGGTGCAA. Internal WT amplicon: 2146 bp. Deletion size: 853 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1275 C47G2.5(ok1740)/mIn1 [mIs14 dpy-10(e128)] II. C47G2.5. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1740 homozygotes (mid-larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GTGGAGTGTGAAGGCCACTT. External right primer: AAAGAACCGCAAAATCGAGA. Internal left primer: AATGCACACTCTGCGTTTTG. Internal right primer: TTCTGGTTGAAAATGAGGGG. Internal WT amplicon: 3279 bp. Deletion size: 1176 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1300 F28C6.1(gk582)/mIn1 [mIs14 dpy-10(e128)] II. F28C6.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk582 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: ATGATAAGACGTCCTTGCCG. External right primer: TGCCTCTGCATTGTTCTCAC. Internal left primer: TGTTTGCACTGTTCGACGTT. Internal right primer: GGCGGATTGATTCATATGCT. Internal WT amplicon: 2222 bp. Deletion size: 1146 bp. Deletion left flank: GCGGTTTTTAAAATAACGTGAATATTGCTT. Deletion right flank: GACAAACACTGAGCGAGAAAACGAATCAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1330 abu-14(ok1789)/mIn1 [mIs14 dpy-10(e128)] II. ZK1067.7. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1789 homozygotes (variable arrest, larval through sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CGAAAACAGAAGTTGTCGCA. External right primer: GTCAACAAACCAAATGCGTG. Internal left primer: AGAATTCAGGGAAGGGGATG. Internal right primer: CTCCGGTTTCCGAGTATGAA. Internal WT amplicon: 2113 bp. Deletion size: 292 bp. Deletion left flank: AAAAGTAGTATTTAAAAAAGAAATTTACCT. Deletion right flank: GCGTTCGAAACAACTCCTTGAATCGGAGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1333 evl-20&cut-3(ok1819)/mIn1 [mIs14 dpy-10(e128)] II. F22B5.1, F22B5.3. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1819 homozygotes (sterile adult, often with vulval blip). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TGATGAACGCTTTTGCAGAC. External right primer: TGAGAACGGTTGTGCTCTTG. Internal left primer: TACCAATTGGACGAGGAAGC. Internal right primer: TTCTTGATGTCCGTGCTGAG. Internal WT amplicon: 2108 bp. Deletion size: 757 bp. Deletion left flank: TGCTTTAATTTGGGTGGTAGATTCGTCAGA. Deletion right flank: AACGGTAAGACCAAGGAAGACAGTGACAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1336 vha-6(ok1825)/mIn1 [mIs14 dpy-10(e128)] II. VW02B12L.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1825 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GAAGCAGAATGGCTCGAACT. External right primer: TCATCCATCATTCCAGAGCA. Internal left primer: GGAACTCGACCCAATGAAGA. Internal right primer: GGTGGCGGTCTGATATTGAT. Internal WT amplicon: 3301 bp. Deletion size: 982 bp. Deletion left flank: GGCTTGACGAGAAGCATAACTGGAACAGAT. Deletion right flank: GGAGCTGGATTAACTTCTCGATAGTTGGCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1345 mtch-1(ok1800)/mIn1 [mIs14 dpy-10(e128)] II. F43E2.7. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1800 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AGCGTATCAAGTCGCTCGTT. External right primer: AAACCTCAGCGGTCAGAAGA. Internal left primer: ATTGGATGGATCATCGGGTA. Internal right primer: GCATCTTCCTCGACTTGTCC. Internal WT amplicon: 2135 bp. Deletion size: 1182 bp. Deletion left flank: CTCGAAAAATACATTATAGCGAAGATTGGA. Deletion right flank: ATTTCTCCTGTAAAACTGAATTTCAAATCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1368 klf-3(gk612)/mIn1 [mIs14 dpy-10(e128)] II. F54H5.4. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk612 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CAGTGCGCAATATCCAGAGA. External right primer: TCATCATTGACTTCCCACCA. Internal left primer: CCGAAAGAGAGTGAAGACGG. Internal right primer: TAAGCTGATCGTTGACCGTG. Internal WT amplicon: 1778 bp. Deletion size: 571 bp. Deletion left flank: TTCCTCTCCCGCAATTTGAATTTTTTCTCT. Deletion right flank: CCATCAAAATGGAGATTCCCATGCATCCGT. klf-3 was formerly known as mua-1. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1396 +/mT1 II; klp-6(ok1869)/mT1 [dpy-10(e128)] III. R144.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1869 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TGCCAGATGAGGAAACAACA. External right primer: CTCAGGTGACACCAAAACGA. Internal left primer: TCGAAGATCTTGGCAGAGGT. Internal right primer: ACATACCCCAACTCAGTGGC. Internal WT amplicon: 3130 bp. Deletion size: 1991 bp. Deletion left flank: ATCGAGAAGGCTGTGTATGTGTGTCAACTT. Deletion right flank: AACAGAACGAGCTCTTCGTGAACTCCGAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1397 +/mT1 II; F25F2.1(ok1876)/mT1 [dpy-10(e128)] III. F25F2.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1876 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTGGAGTATCGCGCATCATA. External right primer: TCCATTGCATCCAAACGTAA. Internal left primer: CCGAATGGCGAGAGATGTAT. Internal right primer: TTTGTTGGCAATGAGTGCAT. Internal WT amplicon: 2539 bp. Deletion size: 1864 bp. Deletion left flank: GACGGATCATGTGGTCATTGCTGAGAAGTT. Deletion right flank: GAATCTGCAGAAGCAGAAGCAACTGCTGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1401 cul-4(ok1891)/mIn1 [mIs14 dpy-10(e128)] II. F45E12.3. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1891 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GATGTTTCAACAAGCAGCGA. External right primer: AGTGGCACGGATAAGGATTG. Internal left primer: CACAACCGCAACAAATGAAC. Internal right primer: GATGAGTGATTCCAGGCGTT. Internal WT amplicon: 3035 bp. Deletion size: 744 bp. Deletion left flank: TCAGACGACACAACTCTCGATCAAATGGTA. Deletion right flank: AGAAGGAAGGTACTGTGGAAAATTTGAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1424 ZK20.4&ZK20.3(ok1910)/mIn1 [mIs14 dpy-10(e128)] II. ZK20.3, ZK20.4. Homozygous lethal/sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1910 homozygotes (late larval arrest or sterile adult with no eggs). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CAGACTTGCATCGTCTCCAA. External right primer: AGAGCCTTCTCAACTGCGAC. Internal left primer: TGACAGGATTCTGGCCTTTT. Internal right primer: AGAAGATTTTTATGGGCGGC. Internal WT amplicon: 2172 bp. Deletion size: 1030 bp. Deletion left flank: AAATTTCTCACTTCGTAGCATCCAAATCTG. Deletion right flank: AATCTGGTTCTTGGTCAGCAGCATCATCAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1426 cul-4(ok1911)/mIn1 [mIs14 dpy-10(e128)] II. F45E12.3. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1911 homozygotes (mid- to late-larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GATGTTTCAACAAGCAGCGA. External right primer: AGTGGCACGGATAAGGATTG. Internal left primer: CACAACCGCAACAAATGAAC. Internal right primer: GATGAGTGATTCCAGGCGTT. Internal WT amplicon: 3035 bp. Deletion size: 918 bp. Deletion left flank: ATGAAGTACGTACACAATTCTCAAAGTATT. Deletion right flank: AATTAATTGCAACAATGTATCAAACTGTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1438 dnj-13&F43D5.7(ok1925)/mIn1 [mIs14 dpy-10(e128)] II. F54D5.8, F54D5.7. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1925 homozygotes (sterile, lays eggs that don't hatch). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CTCTGGAAAGTTCCGCACTC. External right primer: TTTGGAGGGTGAGCTCAAGT. Internal left primer: TTCCATTTCTCCGTGTTTCC. Internal right primer: AGGTGATTGTTGCGGTTTTT. Internal WT amplicon: 2104 bp. Deletion size: 1109 bp. Deletion left flank: AGATGAAGATTACAAGAAAAGTTATGACGG. Deletion right flank: TTAATATTTAAGGCTGGTGTAGTCGAATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1458 dyrb-1&dnj-23(ok1931)/mIn1 [mIs14 dpy-10(e128)] II. T24H10.6, T24H10.3. Homozygous viable deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1931 homozygotes (Sma, Unc, Gro with tail and vulval defects). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TGGCGATTATGGAAGAGGAG. External right primer: ATTGCGATGAGAAAGCTCGT. Internal left primer: ATTCTCGCAAAGGCGACTAA. Internal right primer: CAAGCGTAAGGCTGAGAAGG. Internal WT amplicon: 2301 bp. Deletion size: 1608 bp. Deletion left flank: AGTTAGTAGGAACCAAGTTTGGCGAATACG. Deletion right flank: AAAACTTATAAATAAAGTGACAGATTTTAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1474 K12D12.1(ok1930)/mIn1 [mIs14 dpy-10(e128)] II. K12D12.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1930 homozygotes (sterile Unc with withered tail, often grotty). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TCCAATCAAAGGATTCGAGG. External right primer: ATGTCCTGGCCTTCCTTTTT. Internal left primer: GAACCCCTCAAGATCGCATA. Internal right primer: GGCTCCTTTGGCTCTTTCTT. Internal WT amplicon: 3358 bp. Deletion size: 1788 bp. Deletion left flank: TAGTGACGCTGGAGAAAGTTTTTATCCAGT. Deletion right flank: AGCTCCATGGTACAAGAACTTCCGCGGAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1498 cap-2(ok1929)/mIn1 [mIs14 dpy-10(e128)] II. M106.5. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes) and non-GFP ok1929 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TTTGTTCTTTTTGCACGCTG. External right primer: AGGGAACTGATGTTCCGATG. Internal left primer: CGGGAGCCAATTTACAGAAA. Internal right primer: GAACGAAAATGGTCCAGGAA. Internal WT amplicon: 2129 bp. Deletion size: 1084 bp. Deletion left flank: AAAACAAAAATTTGAAGAACTCTGGCGAAA. Deletion right flank: CTGCAGACAAACAAAAGCTCCAGCGGTGTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1505 npp-3(ok1999)/mIn1 [mIs14 dpy-10(e128)] II. K12D12.2. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1999 homozygotes (early- to mid-larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TCTTGCCAGTGTCAATCAGC. External right primer: TCGCTCTCCACTTCTCCAGT. Internal left primer: CCCCAGAACCACAAGACACT. Internal right primer: TCGATGCTTGATTTGCTGAC. Internal WT amplicon: 3383 bp. Deletion size: 1321 bp. Deletion left flank: GTAACCAACAATCATACGACGAACAGCGAA. Deletion right flank: ATTCGATATATTTGAGGCCTGAAACTCACG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1506 gpb-1(ok1875)/mIn1 [mIs14 dpy-10(e128)] II. F13D12.7. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1875 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TTGATGTGGGGGTTTTAGGA. External right primer: ATCGCGTCGCTCACTAGAAT. Internal left primer: ATCGGGGAGAGAAAGAGAGC. Internal right primer: GGGGCACTATTGCATCATCT. Internal WT amplicon: 2980 bp. Deletion size: 1978 bp. Deletion left flank: GTAGAATACGATCGGGGAGAGAAAGAGAGC. Deletion right flank: ACGAGACACCCGCACGTTTCCCTCGCGTGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1523 dpl-1(gk685)/mIn1 [mIs14 dpy-10(e128)] II. T23G7.1. Apparent homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk685 homozygotes (sterile, with few eggs that don't hatch). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CGATTTCCATCAGCAGTGAA. External right primer: ATACCGGCAGCAGCTAGAAA. Internal left primer: TTTGACAACAATCCAATCGC. Internal right primer: AGCTTGTCGGCTCAACGTAT. Internal WT amplicon: 2352 bp. Deletion size: 871 bp. Deletion left flank: ACAAACCAACCGGACTCAGACATTTTTCCA. Deletion right flank: TGGAAACCACAATTTTCAGACCGTAAAAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1598 acr-20(ok1849)/mT1 II; +/mT1 [dpy-10(e128)] III. R06A4.10. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1849 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGGTCTTTTGGATGACACCG. External right primer: CCGCCAAATTACCTACCAAA. Internal left primer: TACTGTATCCGGAGCCATCC. Internal right primer: TGGGTGGTTGACCAATTTCT. Internal WT amplicon: 3238 bp. Deletion size: 1398 bp. Deletion left flank: CCATCCACCAGTAGAAAAAACCAATCAGAT. Deletion right flank: GATCAGAATAATACAATCCTAACTGTTTTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1611 +/mT1 II; vab-7(gk709)/mT1 [dpy-10(e128)] III. M142.4. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and gk709 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CCTTCCCCTCTTCTATTGGC. External right primer: CGACACGCAACACCAATTAC. Internal left primer: AATCCACCGTAGTCACCGAG. Internal right primer: TCAGAGCATGTTTCCCAGTG. Internal WT amplicon: 2427 bp. Deletion size: 1019 bp. Deletion left flank: TAAATTTTTGTAGTTTTTTAGGGATTTTTT. Deletion right flank: TCACTTGTGGAGATGGTCGCCGCATCTCGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1636 rsp-7&D2089.2(ok2079)/mIn1 [mIs14 dpy-10(e128)] II. D2089.1, D2089.2. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2079 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GAAATTACGTCGCCGGTTTA. External right primer: CACTGTTTTTCGGAGCCAAT. Internal left primer: ACATTTCGACATCGGCTACC. Internal right primer: CACCTCAACTTATTCGGGGA. Internal WT amplicon: 3201 bp. Deletion size: 1429 bp. Deletion left flank: TAAGCCATTTCTCGAAGAAAACAAAGCACA. Deletion right flank: AGATCCAAAGATCGAAAGCGTGACAAGAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC170 cki-1(gk132)/mIn1 [dpy-10(e128) mIs14] II. T05A6.1. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and gk132 homozygotes (embryonic arrest). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1710 dsh-2(ok2164)/mIn1 [mIs14 dpy-10(e128)] II. C27A2.6. Homozygous marginally viable deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2164 homozygotes (mostly sterile; eggs sometimes hatch into abnormal larvae that may grow to adult and reproduce). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AAACCAGACCCACTGCTGAG. External right primer: GAAGCTTTGCTCCGTACGAC. Internal left primer: TTCCGTGAGGAAATGGAGAC. Internal right primer: AATTGACCTGACCTTGGCTG. Internal WT amplicon: 2756 bp. Deletion size: 1177 bp. Deletion left flank: CACACTCATCTCCCATGACGTAGTAGCATT. Deletion right flank: TGGAGATATAAAACCTTTATAAAGTTACCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1739 szy-4(ok2324)/mIn1 [mIs14 dpy-10(e128)] II. C30B5.1, C30B5.2. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2324 homozygotes (sterile, no eggs). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AGGGGTACGGTCGAAAGTCT. External right primer: CCGACTGATCCTTATTCCGA. Internal left primer: AACACAGCGACGTCAGAATG. Internal right primer: GCAAGCATCATCGTCTTCAA. Internal WT amplicon: 2125 bp. Deletion size: 1066 bp. Deletion left flank: TCCAATTCAGATAGCAAACAGTGCATGCTT. Deletion right flank: GGTATCTTTAGTTTTATTTAAAATTTATGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1771 apc-1(gk824)/mIn1 [mIs14 dpy-10(e128)] II. W10C6.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk824 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TATGTGGAACCGAAGGAAGG. External right primer: CAGGCGTTGTTCTTTCACAA. Internal left primer: GGTCTCAGTCACCGGAGAAG. Internal right primer: ATTCAATGACCAACACGGCT. Internal WT amplicon: 2186 bp. Deletion size: 1963 bp. Deletion left flank: TGGAAGAATGCGGAGACTACACGAAAAAAT. Deletion right flank: AAAGTTATGAATTATCGTGCATTCGAGGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807. Formerly known as mat-2.
VC1783 F49E12.6(gk835)/mIn1 [mIs14 dpy-10(e128)] II. F49E12.6. Apparent homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk835 homozygotes (arrest stage/phenotype undetermined). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TGCTCTGGGAACTCTTCGAT. External right primer: GGAGTGGTCGGTGTTGAAGT. Internal left primer: TATTTGGTGACGTGGCATTG. Internal right primer: CCACGTGGTGATGACAACTC. Internal WT amplicon: 2404 bp. Deletion size: 812 bp. Deletion left flank: GGCATAGTTATGGTTTTTCTTATTCTATGT. Deletion right flank: TTTGGGATTGCTCTGTCAAAGATTTCTGAT. Insertion Sequence: TTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1788 ast-1(ok2359)/mIn1 [mIs14 dpy-10(e128)] II. T08H4.3. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2359 homozygotes (embryonic or early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: ATAGGCCACCAGCTTCTCAA. External right primer: CCCAACTACCAACACAGGCT. Internal left primer: GACAATAGCGAAGAGCCGTC. Internal right primer: TGTGATCAAGTATTCGGCCA. Internal WT amplicon: 2386 bp. Deletion size: 946 bp. Deletion left flank: CACAGATAATAGAGCTTTTTGGAGCAGCAC. Deletion right flank: TTCATCGTCGTCGCCGAATCATCGGCGGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1790 ech-4(ok2291)/mIn1 [mIs14 dpy-10(e128)] II. R06F6.9. Apparent homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2291 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CGGTGAGTTTCGTTGGAAAT. External right primer: AAATGCTGCTCAAAAGCGAT. Internal left primer: ATTTCAGGCGTTCAGGATTG. Internal right primer: AACTTTTGTTGCCCGATTTG. Internal WT amplicon: 2356 bp. Deletion size: 1254 bp. Deletion left flank: GCGCAGAAAAATCTGAAAACTCTGAAGGAA. Deletion right flank: AATATCAACTGCTTTGCTCATCAAGAACTA. Insertion Sequence: AA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1794 mop-25.2(ok2073)/mIn1 [mIs14 dpy-10(e128)] II. Y53C12A.4. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2073 homozygotes (sterile with very occasional progeny). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TGATCTGAGCAAGTCGATGG. External right primer: TCTCCTCTGCGATTTTCCTC. Internal left primer: CGGAAAGGGGATGGATATTT. Internal right primer: ACCGGTTTCCCAAATTTTTC. Internal WT amplicon: 2262 bp. Deletion size: 1677 bp. Deletion left flank: TCACAAATGATAATTGTGGTTTTTTTTTGA. Deletion right flank: TTCGATAGCTTTTTCGACTTTCCGCTCACT. Insertion Sequence: TAGCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1796 ZK1127.5&ZK1127.12(ok2279)/mIn1 [mIs14 dpy-10(e128)] II. ZK1127.5, ZK1127.12. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2279 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AATATGTTGCAAAGGACCGC. External right primer: CTCAGCACCTTCCAATCCTC. Internal left primer: TGAATTCTCACAATGGAGCG. Internal right primer: AAATCTGAGCCGGTCCTGTA. Internal WT amplicon: 3074 bp. Deletion size: 1999 bp. Deletion left flank: TTTAGTTTCTATTTGAGCTCAATCCTCAAA. Deletion right flank: ATCTACGGTAACAGTGTCCGATCTACGGTA. Insertion Sequence: GGAAGTGTGAAACATCTTTAGGACAGAGTGTCATAAATGTGCTTGCAAGTATTTGAGCA CTACTGTCAAGGGCACCTCCCATGTAAATTTGTTGAAGAAGAGCATGACCGGCTTCAAT TCCAATGTCTTCTGGAAGAATTGGAACTCCTGATTCGCCCTTCGGTCTTGAAATAGCTT CTGCTTGGTAGATAACACCCTCTGTCGTTTCGGCGGTTAAGAACAGACCATATCCTGGA GAAGCGCCACCAGCATCACCTTTCCGTTGATCAACAGTAATATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1810 pyr-1(ok2391)/mIn1 [mIs14 dpy-10(e128)] II. D2085.1. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2391 homozygotes (sterile, eggs don't hatch). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GAAGCAGCTGAAGAGTTGGG. External right primer: CTCTATTCGCCATCTGAGCC. Internal left primer: AGTTCTTGTCAGAGCCGCAT. Internal right primer: ATTAGCAGGGAAGGCACTCA. Internal WT amplicon: 3370 bp. Deletion size: 2034 bp. Deletion left flank: GGTGTCCGATCATGCTGACGGTTTCTCTCC. Deletion right flank: ATGGCAATTGACAATGGAATTCCCTTGATA. Insertion Sequence: GA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1832 ifb-2(ok2420)/mIn1 [mIs14 dpy-10(e128)] II. F10C1.7. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2420 homozygotes (probable embryonic arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: ACTCTGCTCCTGCTTTGCAT. External right primer: CCGAGTTATCGTGACCCACT. Internal left primer: AGCAGTGGGAGTGCAAGACT. Internal right primer: ACGTCGAATGATTTTGGGAG. Internal WT amplicon: 3175 bp. Deletion size: 2459 bp. Deletion left flank: TGAGGATCGTAACAAGGAGCTTGTGATTGA. Deletion right flank: ACCACCAGACTCAATTGTGATGGAATCTCA. Insertion Sequence: TATTGAAAACTTTTCAGGGTGATATTCCCAGTCTTCTTCAACAAGCTTCACCTCCAGGA GGAGTTAAATCTCCATCAGCTGTAGTATTTCCGCCTGTTTCCGCAGCTGTCGCTGCAAT CACTGAAATTTCTCCACAAAGTAGCTACTCATCAATTGTGCCAAAAGTGGAAACCGATC AAATCTCCCAACAACTATTTAAATGTTAGTTTTTTATGCGATACAATTATTGCATCAAA CTAATTTTCTCATGTTTCCAGCTCTTCCTTTGTGGTCATTCCAACAAACTCCTGGATTA CCTATCGGAATGGATCTATCACAACTTGTTTTCCAACAATCCTCTCCCGACAAAACAGT TTCACCTGTGAAATCAGAAGTTGTAGAAGAAACGAAACCAATCGCTTCTTCACAATTAA CACTTCACAGCTTCTCCGCATATGTCAAATGTAATAAGACAAGTTTAAGGACAGAACTC GTGAAGATTGAGAATACACTGGAAAAAGATGATATTGACATTTCTGTATTTTACGAAAA ATATCCGAAATTACTTCGAGAATTGTTCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1834 C25H3.8(ok2438)/mIn1 [mIs14 dpy-10(e128)] II. C25H3.8. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2438 homozygotes (sterile, lays no eggs). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TCCATCAGCTTCAACAACGA. External right primer: TGAAGCTTGGATGGTGTTCA. Internal left primer: CTTCCATCAGGCATCCAAGT. Internal right primer: CAAAGATGCTCGTGCTTTGA. Internal WT amplicon: 2972 bp. Deletion size: 1859 bp. Deletion left flank: CAAATTTTCAATTCTGATTGGTGGTGGATA. Deletion right flank: GAAGTTTGGTATTCCATTGAATCGATTGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC185 dpy-10(gk24) wrn-1(gk116)/mIn1 [dpy-10(e128) mIs14] II. F18C5.2. Homozygous lethal deletion chromosome linked to dpy-10 mutation, balanced by GFP- and dpy-10-marked inversion. Heterozygotes are Dpy with relatively dim GFP expression in pharynx, and segregates Dpy dim GFP, Dpy bright GFP (mIn1 homozygotes) and gk116 homozygotes (embryonic/early larval arrest). Nature of dpy-10 lesion unknown; recessive lethality could be the result of this mutation. Pick Dpy dim GFP+ and check for correct segregation of progeny to maintain." Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1887 dsh-2(ok2162)/mIn1 [mIs14 dpy-10(e128)] II. C27A2.6. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2162 homozygotes (sterile, lays eggs that don't hatch). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AAACCAGACCCACTGCTGAG. External right primer: GAAGCTTTGCTCCGTACGAC. Internal left primer: TTCCGTGAGGAAATGGAGAC. Internal right primer: AATTGACCTGACCTTGGCTG. Internal WT amplicon: 2756 bp. Deletion size: 1104 bp. Deletion left flank: TTGTAAGCATGCGCCTTTTTAACATAAGTC. Deletion right flank: AGTCTTTCTCTGCGTCTCCTCTTCTTGTGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1888 mmaa-1(ok2514)/mIn1 [mIs14 dpy-10(e128)] II. T02G5.13. Homozygous viable deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2514 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TGATTGGTGCACTGGTCATT. External right primer: AATCACGATACCTTGGACGC. Internal left primer: TCGTTTCGAAATTCGTCCTC. Internal right primer: ATGCCTGGTGACGACTACCT. Internal WT amplicon: 2798 bp. Deletion size: 1179 bp. Deletion left flank: TTTAAGAACAAAAACGTACCAAATGTGCTA. Deletion right flank: ATAGAAATAAGAGATATCAAGTGTTGAAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1889 fars-3&F22B5.10(gk1029)/mIn1 [mIs14 dpy-10(e128)] II. F22B5.10, F22B5.9. fars-3 is the new name for frs-2. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk1029 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TTGTTGTTCCACCCACAAGA. External right primer: TGCCGTTTTCTGCTCTTTTT. Internal left primer: CAGCCAGATGCACTTTCTCA. Internal right primer: CATTTGGGAGTTTGGTGGAG. Internal WT amplicon: 1427 bp. Deletion size: 823 bp. Deletion left flank: TGCAGTTCATATTGGAAATCCAAAAACTCT. Deletion right flank: TATCACATGGCTTCTTGTGTATAGATCCGA. Insertion Sequence: C. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1895 +/mT1 II; cyk-1(ok2300)/mT1 [dpy-10(e128)] III. F11H8.4. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2300 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TCAGCATTTCCTGTAGCACG. External right primer: CAAGATAATCAGGCGAAGGG. Internal left primer: CGGCTTCCTTTCTTGTTGAG. Internal right primer: CGGAATGCAAGCAGGATATT. Internal WT amplicon: 3243 bp. Deletion size: 826 bp. Deletion left flank: TTCAAAAATGTTCGGAATCCTTCAGATGCT. Deletion right flank: GCGGGGGTCCTCCGGTGATTGGAGGAAGAC. Insertion Sequence: TCGGAATCCTTCAGAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1914 C47G2.3(ok2557)/mIn1 [mIs14 dpy-10(e128)] II. C47G2.3. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2557 homozygotes (mid-larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CAATCCGTCTGACTCCTCGT. External right primer: GCTGAAAATGAGGTTTGGGA. Internal left primer: GTTGCAAACCTGGGTGGTAG. Internal right primer: GTACTCCTCCCGGACAATGA. Internal WT amplicon: 2124 bp. Deletion size: 1307 bp. Deletion left flank: TTAGGGTTAGCTGGAAAATTTTTTGATTAA. Deletion right flank: CCGTTTTTGGGATCAATTGGTCTGCTATTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1951 gcy-29(ok2475)/mT1 II; +/mT1 [dpy-10(e128)] III. C04H5.3. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2475 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CTGCCTACGTGGCAAGTACA. External right primer: AAAATGACTCACGAAACGGG. Internal left primer: TGCACGTGGCAAGGTATCTA. Internal right primer: TGCAAAAATGTTGGAGAGCA. Internal WT amplicon: 3309 bp. Deletion size: 1504 bp. Deletion left flank: TTGCAAATTCGGCAGAAGTTGCAGTGTATG. Deletion right flank: TTCAAAATGAACTTCCATACACTTACCTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1990 +/mT1 II; mup-4(ok2321)/mT1 [dpy-10(e128)] III. K07D8.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2321 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTGGATGGCAGGAATTGTTT. External right primer: GCGGTAACGGACTTTGTCAT. Internal left primer: GAAATGAGCACGGGGATTTA. Internal right primer: GCTTCTTCATGTGACTGGCA. Internal WT amplicon: 2913 bp. Deletion size: 1384 bp. Deletion left flank: TATTTTATTTGGTTTTACCTGACTCTGACT. Deletion right flank: AACAGTTTACTTAATAATCAGCTTTATTGA. Insertion Sequence: ACAGTTTACTTAATAATCAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1998 C25H3.11(ok2632)/mIn1 [mIs14 dpy-10(e128)] II. C25H3.11. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP o2632 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TCTGTTGAGCTTTGTTCCCA. External right primer: AAATCGATGAAAATTCCGCA. Internal left primer: AATCAACGCTCACTCGCTCT. Internal right primer: GGAATTCGAAAACCACGATG. Internal WT amplicon: 3051 bp. Deletion size: 1740 bp. Deletion left flank: CTCTCCTGGTTCCCATATTGTAGTTGGACG. Deletion right flank: ACTGTGTCATCTGATGCCTCGTCAATTCTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2013 snr-3&rsp-5(ok2084)/mIn1 [mIs14 dpy-10(e128)] II. T28D9.10, T28D9.2. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2084 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GGTTCCGCAAAGTGCATAAT. External right primer: CTAGGAAGAGCGCGAACAAC. Internal left primer: GTTGACTCGGAAAGCCGTAA. Internal right primer: AGGAAGCGGTGTCCTACTCA. Internal WT amplicon: 3125 bp. Deletion size: 1493 bp. Deletion left flank: AGTATAGGACGTTCGATACTCAAATTTGCT. Deletion right flank: CGTGATCGCAAACGTTCTCGCAGATCCCGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2033 F49E12.6(gk896)/mIn1 [mIs14 dpy-10(e128)] II. F49E12.6. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk896 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TGCTCTGGGAACTCTTCGAT. External right primer: GGAGTGGTCGGTGTTGAAGT. Internal left primer: TATTTGGTGACGTGGCATTG. Internal right primer: CCACGTGGTGATGACAACTC. Internal WT amplicon: 2404 bp. Deletion size: 1777 bp. Deletion left flank: GTTTTGGGAATAAAGCATCTCACAAATAAA. Deletion right flank: CGAATCTACGATATTGTCAATGTAATGGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC206 fzy-1&cyp-44A1(ok312) unc-4(e120)/mIn1 [mIs14 dpy-10(e128)] II. ZK177.6, ZK177.5. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and GFP- hDf35 unc-4 homozygotes (larval/sterile adult arrest). Pick fertile GFP WT to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807