| SP784 |
unc-4(e120) mnDf100/mnC1 [dpy-10(e128) unc-52(e444)] II. |
Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT. |
| SP787 |
unc-4(e120) mnDf95/mnC1 [dpy-10(e128) unc-52(e444)] II. |
|
| SP788 |
unc-4(e120) mnDf96/mnC1 [dpy-10(e128) unc-52(e444)] II. |
Hets are Dpy and segregate Dpy, dead eggs and paralysed DpyUnc. Maintain by picking Dpy. |
| SP789 |
unc-4(e120) mnDf101/mnC1 [dpy-10(e128) unc-52(e444)] II. |
Hets are WT and segregate WT, paralysed DpyUnc and Unc-4 lethals that arrest at L2. Maintain by picking WT. |
| SP790 |
unc-4(e120) mnDf103/mnC1 [dpy-10(e128) unc-52(e444)] II. |
Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT. |
| SP802 |
unc-4(e120) mnDf104/mnC1 [dpy-10(e128) unc-52(e444)] II. |
Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT. |
| SP803 |
unc-4(e120) mnDf105/mnC1 [dpy-10(e128) unc-52(e444)] II. |
Hets are WT and segregate WT, DpyUnc and no viable Unc-4's. Maintain by picking WT. |
| SP804 |
unc-4(e120) mnDf106/mnC1 [dpy-10(e128) unc-52(e444)] II. |
Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT. |
| SP806 |
unc-4(e120) mnDf108/mnC1 [dpy-10(e128) unc-52(e444)] II. |
Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT. |
| SP807 |
unc-4(e120) mnDf109/mnC1 [dpy-10(e128) unc-52(e444)] II. |
Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT. [12/93 **mnC1 appears to have broken down**] |
| SS186 |
mes-2(bn11) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. |
Heterozygotes are WT and segregate WT, DpyUnc and Uncs which give sterile progeny (maternal effect sterile: the progeny from mutant mothers are sterile). The mutation is a strict mel, fully penetrant, and fully expressed. Sterility is due to a failure in germ-cell proliferation. |
| SS746 |
klp-19(bn126)/mT1 [dpy-10(e128)] III. |
Heterozygotes are WT and segregate WT, Dpys (mT1 homozygotes) and L1 lethals (bn126 homozygotes). klp-19 deletion is 435 bases between TTCACAGTGTTCGTGGAGAA and GCAAGGAATCGCGCCGGCT. klp-19 deletion is lethal over hT2. |
| SSM596 |
rpa-1(iow117)/mIn1[mIs14 dpy-10(e128)] II. |
Crispr/Cas9-engineered indel in the 5’ region of rpa-1. Larval-lethal mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are wild-type with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP iow117 homozygotes (larval lethal). Pick wild-type dim GFP and check for correct segregation of progeny to maintain. iow117 was generated in mre-11::GFP background and outcrossed to N2. Reference: Hefel et al., Nucleic Acids Res. 2021 Jan 21;gkaa1293. doi: 10.1093/nar/gkaa1293. |
| ST13 |
klf-3(nc13)/dpy-10(e128) unc-53(n569) II; him-8(e1489) IV. |
Heterozygotes are WT and segregate WT, Dpy Uncs, and animals with muscle attachment defects and ventral cord displacement and detachment. Not well balanced. klf-3 was formerly known as mua-1. |
| ST29 |
ven-2(nc29)/mnC1 [dpy-10(e128) unc-52(e444)] II; ncIs3 III. |
ncIs3 [pH20::GFP + pBlueScript]. Expresses GFP in nearly all neurons. Heterozygotes are WT and segregate WT, DpyUncs, and animals with muscle attachment defects and ventral cord displacement and detachment which arrest in larval development. |
| ST30 |
spon-1(nc30) ncIs2/dpy-10(e128) unc-53(n569) II. |
ncIs2 [pH20::GFP + pBlueScript]. Heterozygotes are WT and segregate WT, DpyUnc, and animals with muscle attachment defects and ventral cord displacement and detachment which arrest in larval development. Not well balanced. Neurons visualized with ncIs2. |
| SU351 |
mig-5(rh94)/mIn1 [dpy-10(e128) mIs14] II. |
Heterozygotes are WT with GFP in pharynx. Segregate Dpy and GFP+. mig-5 homozygotes are non-GFP and show a weakly penetrant gonad defect and a fully penetrant QL.d migration defect. |
| SU352 |
mig-5(rh147)/mIn1 [dpy-10(e128) mIs14] II. |
Heterozygotes are WT with GFP in pharynx. Segregate Dpy and GFP+. mig-5 homozygotes are non-GFP and show a weakly penetrant gonad defect and a fully penetrant QL.d migration defect. |
| SV122 |
lin-5(n3070)/mnC1 [dpy-10(e128) unc-52(e444)] II. |
Heterozygotes are WT and segregate WT, Stu and DpyUncs. n3070 is a strong loss-of-function or null allele. Molecular lesion: P to S at position 24 as well as an amber mutation terminating translation after amino acid 52. DNA replication continues in the absence of mitosis. Mutants enter mitotis at the normal time and form bipolar spindles, but fail chromosome alignment at the metaphase plate, sister chromatid separation and cytokinesis. |
| SV123 |
lin-5(n3066)/mnC1 [dpy-10(e128) unc-52(e444)] II. |
Heterozygotes are WT and segregate WT, Stu and DpyUncs. n3066 is a strong loss-of-function or null allele. Molecular lesion: ochre mutation terminating translation at amino acid 538. DNA replication continues in the absence of mitosis. Mutants enter mitotis at the normal time and form bipolar spindles, but fail chromosome alignment at the metaphase plate, sister chromatid separation and cytokinesis. |
| SV13 |
lin-5(e1348)/mnC1 [dpy-10(e128) unc-52(e444)] II. |
Heterozygotes are WT and segregate WT, Stu and DpyUncs. Molecular lesion: amber mutation terminating translation at amino acid 159. DNA replication continues in the absence of mitosis. Mutants enter mitotis at the normal time and form bipolar spindles, but fail chromosome alignment at the metaphase plate, sister chromatid separation and cytokinesis. |
| SV314 |
rol-1(e91) cyd-1(he112)/mnC1 [dpy-10(e28) unc-52(e444)] II. |
Heterozygotes are WT and segregate WT, DpyUncs, and rol-1 cyd-1 homozygotes which are thin, sterile, uncoordinated animals. rol-1 is largely suppressed by cyd-1. No postembryoinc cell divisions take place in cyd-1. |
| SV329 |
rol-1(e91) cyd-1(he116)/mnC1 [dpy-10(e128) unc-52(e444)] II. |
Heterozygotes are WT and segregate WT, DpyUncs, and rol-1 cyd-1 homozygotes which are thin, sterile, uncoordinated animals. rol-1 is largely suppressed by cyd-1. No postembryoinc cell divisions take place in cyd-1. |
| SV46 |
lin-5(e1457)/mnC1 [dpy-10(e128) unc-52(e444)] II. |
Heterozygotes are WT and segregate WT, Stu and DpyUncs. e1457 is a strong loss-of-function or null allele. Molecular lesion: G to E at position 40. DNA replication continues in the absence of mitosis. Mutants enter mitotis at the normal time and form bipolar spindles, but fail chromosome alignment at the metaphase plate, sister chromatid separation and cytokinesis. |
| TJ1049 |
dpy-10(e128) emb-27(g48) II. |
Temperature sensitive. Dpy. |
| TN64 |
dpy-10(cn64) II. |
Temperature sensitive. Dpy when grown at 15C. DpyRoller when grown at 25C. Heterozygotes are Rollers at any temperature. |
| VC10002 |
bli-2(e768) F10E7.2&spon-1&F10E7.11(gk460) unc-4(e120)/mIn1 [mIs14 dpy-10(e128)] II. |
F10E7.2, F10E7.4, F10E7.11. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and Unc non-GFP gk460 homozygotes (probable embryonic arrest; bli-2 not evident until adult stage). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AACAATGTTTGGTCCATCCC. External right primer: ACACCAGGTTGACCTCCTTG. Internal left primer: ATGAGCCCAAATGAACCAAC. Internal right primer: AATAGGCACAATACGCCTGC. Internal WT PCR product: 5051. Deletion size: 4507 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC10005 |
ast-1(gk463) bli-2(e768) unc-4(e120)/mIn1 [mIs14 dpy-10(e128)] II. |
T08H4.3. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and Unc non-GFP gk463 homozygotes (larval arrest; bli-2 not evident until adult stage). Pick WT dim GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC10007 |
bli-2(e768) C06A8.1(gk465) unc-4(e120)/mIn1 [mIs14 dpy-10(e128)] II. |
C06A8.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and Unc non-GFP gk465 homozygotes (larval arrest; bli-2 not evident until adult stage). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: ACTGCAATCGGAGTGGTTTC. External right primer: GGGAATCATGCCAATTATGG. Internal left primer: GGTCATGAAGCATTCGAGGT. Internal right primer: GAACAGAGCGTTGCATTGAA. Internal WT PCR product: 718. Deletion size: 141 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC1012 |
+/mT1 II; pxl-1(ok1483)/mT1 [dpy-10(e128)] III. |
C28H8.6. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1483 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC1016 |
szy-4(ok1416)/mIn1 [mIs14 dpy-10(e128)] II. |
C30B5.1. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1416 homozygotes (sterile adult, explodes at vulva). Pick WT dim GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC1033 |
cul-4(gk434)/mIn1 [mIs14 dpy-10(e128)] II. |
F45E12.3. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk434 homozygotes (mid-larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC1038 |
+/mT1 II; set-16(gk438)/mT1 [dpy-10(e128)] III. |
T12D8.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and gk438 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC1046 |
+/mT1 II; abce-1(gk481)/mT1 [dpy-10(e128)] III. |
Y39E4B.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and gk481 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC1049 |
C06A8.5(ok1515)/mIn1 [mIs14 dpy-10(e128)] II. |
C06A8.5. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1515 homozygotes (sterile adult, often with vulval blip). Pick WT dim GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC1082 |
F55C12.1a(gk522)/mIn1 [mIs14 dpy-10(e128)] II. |
F55C12.1a. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk522 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC1111 |
+/mT1 II; T12D8.1&T12D8.2(gk445)/mT1 [dpy-10(e128)] III. |
T12D8.1, T12D8.2. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and gk445 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC1112 |
cul-4(gk511)/mIn1 [mIs14 dpy-10(e128)] II. |
F45E12.3. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk511 homozygotes (late larval arrest or sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC1117 |
+/mT1 II; paa-1(ok1539)/mT1 [dpy-10(e128)] III. |
F48E8.5. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1539 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TCTCTGCGTATCACTGTCGC. External right primer: CAGAGTTTTGTCTCGAGGGC. Internal left primer: CTCTTGTTCTCCTCATGCCC. Internal right primer: CTCGGGAACAAAAATGGAAA. Internal WT amplicon: 2209 bp. Deletion size: 621 bp. Deletion left flank: TTGGCGTTGGGTGTGGAGCGCACACGCAAC. Deletion right flank: AAGAAGAAACTCATCGAGCCAATTCTCATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC1123 |
F55C12.1(gk515)/mIn1 [mIs14 dpy-10(e128)] II. |
F55C12.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk515 homozygotes (late larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC1135 |
R166.3(gk541)/mIn1 [mIs14 dpy-10(e128)] II. |
R166.3. Homozygous marginally-viable deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk541 homozygotes (mostly sterile; some animals bear a few progeny, but a population may be difficult to maintain). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GAGGAGTACACGCCGGATAA. External right primer: AGACCATTTTGCAGGATTGC. Internal left primer: AAGTGCTGACCGAAGAGCAT. Internal right primer: TGGGATTTGAAACGAGAACC. Internal WT amplicon: 1529 bp. Deletion size: 388 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC114 |
T19E10.1a(gk44)/mIn1 [dpy-10(e128) mIs14] II. |
T19E10.1a. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and gk44 homozygotes (sterile). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC1153 |
+/mT1 II; him-10(ok263)/mT1 [dpy-10(e128)] III. |
R12B2.4. Homozygous sterile deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok263 homozygotes (sterile Unc). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC1158 |
T07F8.4(gk530)/mIn1 [mIs14 dpy-10(e128)] II. |
T07F8.4. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk530 homozygotes (sterile adult, lays no eggs). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TCACTTGGCTGATTCGTCTG. External right primer: TGTGCAAATGGATCAGGTGT. Internal left primer: CCTTCAACCGTTGCTTCATT. Internal right primer: ACAGAACGATCGGGAAGTTG. Internal WT amplicon: 1857 bp. Deletion size: 974 bp. Deletion left flank: GGTTCTGCAGCAGCCGAACTTGATTCCCCT. Deletion right flank: TTACTGAGCAAACGCTTTAGTGTTAGAAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC1162 |
+/mT1 II; spe-41(ok1590)/mT1 [dpy-10(e128)] III. |
K01A11.4. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1590 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TCACTATCCCCACAGAAGCC. External right primer: ATACCTACGCCCGCCTACTT. Internal left primer: GCGCGTAAACTTCTTTCCAG. Internal right primer: TCTCCACATTTTCCACCACA. Internal WT amplicon: 3007 bp. Deletion size: 1099 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC1165 |
let-19&sgn-1(ok331)/mIn1 [mIs14 dpy-10(e128)] II. |
F07H5.2, K08F8.6. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok331 homozygotes (grotty sterile Dpy with vulval blip). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TGAAAATTGGGAGTTCGGAG. External right primer: ACCACTTGTTCCTTGCCAAC. Internal left primer: GGACTGGAAACTCCAAGCAG. Internal right primer: GACTGATGAGCCGGTATGGT. Internal WT amplicon: 2637 bp. Deletion size: 1456 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC1166 |
+/mT1 II; brc-2(ok1629)/mT1 [dpy-10(e128)] III. |
T07E3.5. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1629 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CATGGAAACAACAGAAGGGG. External right primer: GAGCCATTTTGAAGTTTGGC. Internal left primer: CGGCGTTTCTTCTTGTCTTC. Internal right primer: AAAATCAGGTTTTCATGGCG. Internal WT amplicon: 3006 bp. Deletion size: 809 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC1175 |
+/mT1 II; F37C12.13(ok1635)/mT1 [dpy-10(e128)] III. |
F37C12.13. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1635 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC1203 |
+/mT1 II; apc-2(ok1657)/mT1 [dpy-10(e128)] III. |
K06H7.6. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1657 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TCACGCAAAATACGCAAAAA. External right primer: GGAAGTGCTGATTTGGCAGT. Internal left primer: ATGACGACAGTTCTGCAACG. Internal right primer: GGCTGACGATCTCTTGGAAA. Internal WT amplicon: 3306 bp. Deletion size: 650 bp. Deletion left flank: CCTAAATTATATATAACATTTTCAGAAAAA. Deletion right flank: GACCTGACACTGTACAACAAATTATCAGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC1224 |
polg-1(ok1548)/mT1 II; +/mT1 [dpy-10(e128)] II. |
Y57A10A.15. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1548 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Outer Left Sequence: ACCGTAGCCCTTTCCTCATC. Outer Right Sequence: CGCATTTCCCATCTGTCTTT. Inner Left Sequence: ACCTCTTCGTTTTGGGGATT. Inner Right Sequence: CCATCCGGCCTATTTAATCA. Inner Primer WT PCR Product: 3241. Deletion size: 2149 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |